Text Size:AAA

Human ALDH1A3/RALDH3 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human ALDH1A3 cDNA Clone Product Information
    NCBI RefSeq:NM_000693.2
    RefSeq ORF Size:1539bp
    cDNA Description:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 1 family, member A3 with C terminal HA tag.
    Gene Synonym:ALDH6, RALDH3, ALDH1A6, ALDH1A3
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ALDH1A3 qPCR primers for gene expression analysis, HP101487 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), also known as Retinaldehyde dehydrogenase 3 (RALDH3), which belongs to the aldehyde dehydrogenase family. ALDH1A3 is a novel Cancer stem cell (CSC) marker with potential clinical prognostic applicability, and demonstrates a clear correlation between CSC prevalence and the development of metastatic breast cancer. The retinoic acid (RA) biosynthesis enzyme aldehyde dehydrogenase 1A3 (ALDH1A3) is a putative androgen-responsive gene in human prostate cancer epithelial (LNCaP) cells. The RA biosynthesis enzyme ALDH1A3 is androgen responsive and (ii) DHT up-regulation of ALDH1A3 can increase the oxidation of retinal to RA and indirectly affect RA bioactivity and metabolism.

    References
  • Marcato P, et al. (2011) Aldehyde dehydrogenase activity of breast cancer stem cells is primarily due to isoform ALDH1A3 and its expression is predictive of metastasis. Stem Cells. 29(1)32-45.
  • Trasino SE, et al. (2007) Androgen regulation of aldehyde dehydrogenase 1A3 (ALDH1A3) in the androgen-responsive human prostate cancer cell line LNCaP. Exp Biol Med (Maywood). 232(6): 762-71.
  • Size / Price
    Catalog: HG11636-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"