AKT3 cDNA ORF Clone, Human, N-His tag

Cat: HG10765-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AKT3 Reagents
CRO Services
Product recommended

All AKT3 Reagents
AKT3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1440 bp
Description
Full length Clone DNA of Human v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKT3 cDNA ORF Clone, Human, N-His tag Alternative Names
MPPH cDNA ORF Clone, Human;MPPH2 cDNA ORF Clone, Human;PKB-GAMMA cDNA ORF Clone, Human;PKBG cDNA ORF Clone, Human;PRKBG cDNA ORF Clone, Human;RAC-gamma cDNA ORF Clone, Human;RAC-PK-gamma cDNA ORF Clone, Human;STK-2 cDNA ORF Clone, Human
AKT3 Background Information

v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers of Akt kinase family, share extensive structural similarity and perform common as well as unique functions within cells. The Akt signaling cascade initiates at the cell surface when growth factors or other extracellular stimuli activate phosphoinositide 3-kinase (PI3K). AKT3 was discovered to be the predominant isoform activated in sporadic melanomas. Levels of activity increased during melanoma progression with metastatic melanomas having the highest activity. Although mechanisms of AKT3 activation remain to be fully characterized, overexpression of AKT3 and decreased PTEN activity play important roles in this process. Targeted reduction of AKT3 activity decreased survival of melanoma tumor cells leading to inhibition of tumor development, which may be therapeutically effective for shrinking tumors in melanoma patients. AKT2 and AKT3 play an important role in the viability of human malignant glioma cells. Targeting AKT2 and AKT3 may hold promise for the treatment of patients with gliomas.

Full Name
v-akt murine thymoma viral oncogene homolog 3
References
  • Mure H, et al. (2010) Akt2 and Akt3 play a pivotal role in malignant gliomas. Neuro Oncol. 12(3): 221-32.
  • Koseoglu S, et al. (2007) AKT1, AKT2 and AKT3-dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther. 6(5): 755-62.
  • Cristiano BE, et al. (2006) A specific role for AKT3 in the genesis of ovarian cancer through modulation of G(2)-M phase transition. Cancer Res. 66(24): 11718-25.
  • Robertson GP. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev. 24(2): 273-85.
  • Altomare DA, et al. (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene. 24: 7455-64.
  • Stahl JM, et al. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 64: 7002-10.
  • AKT3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    AKT3 cDNA ORF Clone in Cloning Vector, Mouse MG51027-G
    AKT3 cDNA ORF Clone, Mouse, untagged MG51027-UT
    AKT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51027-ACGLN
    AKT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51027-ACG
    AKT3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51027-ANG
    AKT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51027-ACR
    AKT3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51027-ANR
    AKT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51027-CF
    AKT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51027-NF
    AKT3 cDNA ORF Clone, Mouse, C-His tag MG51027-CH
    AKT3 cDNA ORF Clone, Mouse, N-His tag MG51027-NH
    AKT3 cDNA ORF Clone, Mouse, C-HA tag MG51027-CY
    AKT3 cDNA ORF Clone, Mouse, N-HA tag MG51027-NY
    AKT3 cDNA ORF Clone, Mouse, C-Myc tag MG51027-CM
    AKT3 cDNA ORF Clone, Mouse, N-Myc tag MG51027-NM
    AKT3 qPCR Primer Pairs, Mouse MP200986

    AKT3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    AKT3 cDNA ORF Clone in Cloning Vector, Human HG10765-G
    AKT3 cDNA ORF Clone, Human, untagged HG10765-UT
    AKT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10765-ACGLN
    AKT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10765-ACG
    AKT3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10765-ANG
    AKT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10765-ACR
    AKT3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10765-ANR
    AKT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10765-CF
    AKT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10765-NF
    AKT3 cDNA ORF Clone, Human, C-His tag HG10765-CH
    AKT3 cDNA ORF Clone, Human, C-HA tag HG10765-CY
    AKT3 cDNA ORF Clone, Human, N-HA tag HG10765-NY
    AKT3 cDNA ORF Clone, Human, C-Myc tag HG10765-CM
    AKT3 cDNA ORF Clone, Human, N-Myc tag HG10765-NM
    AKT3 qPCR Primer Pairs, Human HP100904
    info info
    添加购物车成功! 添加购物车失败!