AKR1B1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11294-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AKR1B1 Reagents
CRO Services
Product recommended

All AKR1B1 Reagents
AKR1B1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
996 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human aldo-keto reductase family 1, member B1 (aldose reductase) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
HindIII + XbaI(6kb+1kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
AKR1B1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKR1B1 cDNA ORF Clone, Human, C-Myc tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5621
AKR1B1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
ADR cDNA ORF Clone, Human;ALDR1 cDNA ORF Clone, Human;ALR2 cDNA ORF Clone, Human;AR cDNA ORF Clone, Human;MGC1804 cDNA ORF Clone, Human
AKR1B1 Background Information

Aldose reductase (AKR1B1) belongs to the aldo/keto reductase superfamily. AKR1B1 is a NADPH-dependent aldo-keto reductase best known as the rate-limiting enzyme of the polyol pathway. Expression of AKR1B1 was the highest in lens and retina. It is the first enzyme in the polyol pathway through which glucose is converted to sorbitol which is important for the function of various organs in the body, and has been implicated in the etiology of diabetic complications. AKR1B1 is quite abundant in the collecting tubule cells and thought to provide protection against hypertonic environment. Some human tissues contain AKR1B1 as well as AKR1B10, a closely related member of the aldo-keto reductase superfamily. 

Full Name
aldo-keto reductase family 1, member B1 (aldose reductase)
References
  • Huang SP, et al. (2010) Aldo-Keto Reductases in the Eye. Journal of Ophthalmology. 326 (3): 625-36.
  • Aida K, et al. (2000) Disruption of Aldose Reductase Gene (Akr1b1) Causes Defect in Urinary Concentrating Ability and Divalent Cation Homeostasis. Biochemical and Biophysical Research Communications.277 (2): 281-6.
  • Liao CS, et al. (2009) Regulation of AKR1B1 by thyroid hormone and its receptors. Molecular and Cellular Endocrinology. 307 (1-2): 109-17.
  • Baba SP, et al. (2009) Posttranslational glutathiolation of aldose reductase (AKR1B1): A possible mechanism of protein recovery from S-nitrosylation. Chemico-Biological Interactions. 178 (1-3): 250-8.
  • info info
    添加购物车成功! 添加购物车失败!