AKR1A1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11607-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AKR1A1 Reagents
CRO Services
Product recommended

All AKR1A1 Reagents
AKR1A1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
978 bp
Description
Full length Clone DNA of Human aldo-keto reductase family 1, member A1 (aldehyde reductase) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKR1A1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ALDR1 cDNA ORF Clone, Human;ALR cDNA ORF Clone, Human;ARM cDNA ORF Clone, Human;DD3 cDNA ORF Clone, Human;HEL-S-6 cDNA ORF Clone, Human
AKR1A1 Background Information

Aldehyde reductase (AKR1A1) is a member of the aldo-keto reductase superfamily, which consists of more than 40 known enzymes and proteins that includes variety of monomeric NADPH-dependent oxidoreductases, such as aldehyde reductase. Aldehyde reductase has wide substrate specificities for carbonyl compounds. These enzymes are implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Aldehyde reductase possess a structure with a beta-alpha-beta fold which contains a novel NADP-binding motif. The binding site is located in a large, deep, elliptical pocket in the C-terminal end of the beta sheet, the substrate being bound in an extended conformation. This binding is more similar to FAD- than to NAD(P)-binding oxidoreductases. AKR1A1 is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue.

Full Name
aldo-keto reductase family 1, member A1 (aldehyde reductase)
References
  • Bohren KM, et al. (1989) The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J Biol Chem. 264 (16): 9547-51.
  • Fujii J, et al. (1999) The structural organization of the human aldehyde reductase gene, AKR1A1, and mapping to chromosome. Cytogenetics and Cell Genetics . 84 (3-4): 33-2.
  • AKR1A1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    AKR1A1 cDNA ORF Clone in Cloning Vector, Rat RG80786-U
    AKR1A1 cDNA ORF Clone, Rat, untagged RG80786-UT
    AKR1A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80786-ACG
    AKR1A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80786-ACGLN
    AKR1A1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80786-ANG
    AKR1A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80786-ACR
    AKR1A1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80786-ANR
    AKR1A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80786-CF
    AKR1A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80786-NF
    AKR1A1 cDNA ORF Clone, Rat, C-His tag RG80786-CH
    AKR1A1 cDNA ORF Clone, Rat, N-His tag RG80786-NH
    AKR1A1 cDNA ORF Clone, Rat, C-HA tag RG80786-CY
    AKR1A1 cDNA ORF Clone, Rat, N-HA tag RG80786-NY
    AKR1A1 cDNA ORF Clone, Rat, C-Myc tag RG80786-CM
    AKR1A1 cDNA ORF Clone, Rat, N-Myc tag RG80786-NM
    AKR1A1 qPCR Primer Pairs, Rat RP300750

    AKR1A1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    AKR1A1 cDNA ORF Clone in Cloning Vector, Mouse MG52953-G
    AKR1A1 cDNA ORF Clone, Mouse, untagged MG52953-UT
    AKR1A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52953-ACGLN
    AKR1A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52953-ACG
    AKR1A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52953-ANG
    AKR1A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52953-ACR
    AKR1A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52953-ANR
    AKR1A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52953-CF
    AKR1A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52953-NF
    AKR1A1 cDNA ORF Clone, Mouse, C-His tag MG52953-CH
    AKR1A1 cDNA ORF Clone, Mouse, N-His tag MG52953-NH
    AKR1A1 cDNA ORF Clone, Mouse, C-HA tag MG52953-CY
    AKR1A1 cDNA ORF Clone, Mouse, N-HA tag MG52953-NY
    AKR1A1 cDNA ORF Clone, Mouse, C-Myc tag MG52953-CM
    AKR1A1 cDNA ORF Clone, Mouse, N-Myc tag MG52953-NM

    AKR1A1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    AKR1A1 cDNA ORF Clone in Cloning Vector, Human HG11607-M
    AKR1A1 cDNA ORF Clone, Human, untagged HG11607-UT
    AKR1A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11607-ACGLN
    AKR1A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11607-ACG
    AKR1A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11607-ANG
    AKR1A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11607-ACR
    AKR1A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11607-ANR
    AKR1A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11607-CF
    AKR1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11607-NF
    AKR1A1 cDNA ORF Clone, Human, C-His tag HG11607-CH
    AKR1A1 cDNA ORF Clone, Human, N-His tag HG11607-NH
    AKR1A1 cDNA ORF Clone, Human, C-HA tag HG11607-CY
    AKR1A1 cDNA ORF Clone, Human, N-HA tag HG11607-NY
    AKR1A1 cDNA ORF Clone, Human, C-Myc tag HG11607-CM
    AKR1A1 qPCR Primer Pairs, Human HP101468
    info info
    添加购物车成功! 添加购物车失败!