AK3L1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG12406-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AK3L1 Reagents
CRO Services
Product recommended

All AK3L1 Reagents
AK3L1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
672 bp
Description
Full length Clone DNA of Human adenylate kinase 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AK3L1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
AK3 cDNA ORF Clone, Human;AK3L1 cDNA ORF Clone, Human;AK3L2 cDNA ORF Clone, Human;AK4 cDNA ORF Clone, Human
AK3L1 Background Information

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Full Name
adenylate kinase 4
References
  • Xu G., et al.,(1992), Characterization of human adenylate kinase 3 (AK3) cDNA and mapping of the AK3 pseudogene to an intron of the NF1 gene. Genomics 13:537-542.
  • Gregory S.G., et al., (2006), The DNA sequence and biological annotation of human chromosome 1.Nature 441:315-321.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • AK3L1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    AK3L1 cDNA ORF Clone in Cloning Vector, Mouse MG52601-U
    AK3L1 cDNA ORF Clone, Mouse, untagged MG52601-UT
    AK3L1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52601-ACGLN
    AK3L1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52601-ACG
    AK3L1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52601-ANG
    AK3L1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52601-ACR
    AK3L1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52601-ANR
    AK3L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52601-CF
    AK3L1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52601-NF
    AK3L1 cDNA ORF Clone, Mouse, C-His tag MG52601-CH
    AK3L1 cDNA ORF Clone, Mouse, N-His tag MG52601-NH
    AK3L1 cDNA ORF Clone, Mouse, C-HA tag MG52601-CY
    AK3L1 cDNA ORF Clone, Mouse, N-HA tag MG52601-NY
    AK3L1 cDNA ORF Clone, Mouse, C-Myc tag MG52601-CM
    AK3L1 cDNA ORF Clone, Mouse, N-Myc tag MG52601-NM
    AK3L1 qPCR Primer Pairs, Mouse MP202472

    AK3L1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    AK3L1 cDNA ORF Clone in Cloning Vector, Human HG12406-G
    AK3L1 cDNA ORF Clone, Human, untagged HG12406-UT
    AK3L1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12406-ACG
    AK3L1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12406-ACGLN
    AK3L1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12406-ANG
    AK3L1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12406-ACR
    AK3L1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12406-ANR
    AK3L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12406-CF
    AK3L1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12406-NF
    AK3L1 cDNA ORF Clone, Human, C-His tag HG12406-CH
    AK3L1 cDNA ORF Clone, Human, N-His tag HG12406-NH
    AK3L1 cDNA ORF Clone, Human, C-HA tag HG12406-CY
    AK3L1 cDNA ORF Clone, Human, N-HA tag HG12406-NY
    AK3L1 cDNA ORF Clone, Human, N-Myc tag HG12406-NM
    AK3L1 qPCR Primer Pairs, Human HP104574
    info info
    添加购物车成功! 添加购物车失败!