AJAP1 cDNA ORF Clone, Human, untagged

Cat: HG13392-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AJAP1 Reagents
CRO Services
Product recommended

All AJAP1 Reagents
AJAP1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Description
Full length Clone DNA of Human adherens junctions associated protein 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AJAP1 cDNA ORF Clone, Human, untagged Alternative Names
MOT8 cDNA ORF Clone, Human;SHREW-1 cDNA ORF Clone, Human;SHREW1 cDNA ORF Clone, Human
AJAP1 Background Information
Full Name
adherens junctions associated protein 1

AJAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AJAP1 cDNA ORF Clone in Cloning Vector, Mouse MG52275-G
AJAP1 cDNA ORF Clone, Mouse, untagged MG52275-UT
AJAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52275-ACGLN
AJAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52275-ACG
AJAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52275-ACR
AJAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52275-CF
AJAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52275-NF
AJAP1 cDNA ORF Clone, Mouse, C-His tag MG52275-CH
AJAP1 cDNA ORF Clone, Mouse, N-His tag MG52275-NH
AJAP1 cDNA ORF Clone, Mouse, C-HA tag MG52275-CY
AJAP1 cDNA ORF Clone, Mouse, N-HA tag MG52275-NY
AJAP1 cDNA ORF Clone, Mouse, C-Myc tag MG52275-CM
AJAP1 cDNA ORF Clone, Mouse, N-Myc tag MG52275-NM
AJAP1 qPCR Primer Pairs, Mouse MP202148

AJAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AJAP1 cDNA ORF Clone in Cloning Vector, Human HG13392-G
AJAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13392-ACGLN
AJAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13392-ACG
AJAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13392-ACR
AJAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13392-CF
AJAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13392-NF
AJAP1 cDNA ORF Clone, Human, C-His tag HG13392-CH
AJAP1 cDNA ORF Clone, Human, N-His tag HG13392-NH
AJAP1 cDNA ORF Clone, Human, C-HA tag HG13392-CY
AJAP1 cDNA ORF Clone, Human, N-HA tag HG13392-NY
AJAP1 cDNA ORF Clone, Human, C-Myc tag HG13392-CM
AJAP1 cDNA ORF Clone, Human, N-Myc tag HG13392-NM
AJAP1 qPCR Primer Pairs, Human HP102096
info info
添加购物车成功! 添加购物车失败!