JTV1 cDNA ORF Clone, Human, C-His tag

Cat: HG14103-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All JTV1 Reagents
CRO Services
Product recommended

All JTV1 Reagents
JTV1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
963 bp
Description
Full length Clone DNA of Human JTV1 gene with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

JTV1 cDNA ORF Clone, Human, C-His tag Alternative Names
JTV-1 cDNA ORF Clone, Human;JTV1 cDNA ORF Clone, Human;P38 cDNA ORF Clone, Human;PRO0992 cDNA ORF Clone, Human
JTV1 Background Information
Full Name
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2

JTV1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
JTV1 cDNA ORF Clone in Cloning Vector, Rat RG8A1908-U
JTV1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1908-ACGLN

JTV1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
JTV1 cDNA ORF Clone in Cloning Vector, Mouse MG53883-U
JTV1 cDNA ORF Clone, Mouse, untagged MG53883-UT
JTV1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53883-ACGLN
JTV1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53883-ACG
JTV1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53883-ANG
JTV1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53883-ACR
JTV1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53883-ANR
JTV1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53883-CF
JTV1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53883-NF
JTV1 cDNA ORF Clone, Mouse, C-His tag MG53883-CH
JTV1 cDNA ORF Clone, Mouse, N-His tag MG53883-NH
JTV1 cDNA ORF Clone, Mouse, C-HA tag MG53883-CY
JTV1 cDNA ORF Clone, Mouse, N-HA tag MG53883-NY
JTV1 cDNA ORF Clone, Mouse, C-Myc tag MG53883-CM
JTV1 cDNA ORF Clone, Mouse, N-Myc tag MG53883-NM

JTV1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
JTV1 cDNA ORF Clone in Cloning Vector, Human HG16434-G
JTV1 cDNA ORF Clone in Cloning Vector, Human HG14103-G
JTV1 cDNA ORF Clone, Human, untagged HG14103-UT
JTV1 cDNA ORF Clone, Human, untagged HG16434-UT
JTV1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14103-ACG
JTV1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16434-ACGLN
JTV1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14103-ACGLN
JTV1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16434-ACG
JTV1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14103-ANG
JTV1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16434-ANG
JTV1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14103-ACR
JTV1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16434-ACR
JTV1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16434-ANR
JTV1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14103-ANR
JTV1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16434-CF
JTV1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14103-CF
JTV1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16434-NF
JTV1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14103-NF
JTV1 cDNA ORF Clone, Human, C-His tag HG16434-CH
JTV1 cDNA ORF Clone, Human, N-His tag HG14103-NH
JTV1 cDNA ORF Clone, Human, N-His tag HG16434-NH
JTV1 cDNA ORF Clone, Human, C-HA tag HG16434-CY
JTV1 cDNA ORF Clone, Human, C-HA tag HG14103-CY
JTV1 cDNA ORF Clone, Human, N-HA tag HG14103-NY
JTV1 cDNA ORF Clone, Human, N-HA tag HG16434-NY
JTV1 cDNA ORF Clone, Human, C-Myc tag HG16434-CM
JTV1 cDNA ORF Clone, Human, C-Myc tag HG14103-CM
JTV1 cDNA ORF Clone, Human, N-Myc tag HG14103-NM
JTV1 cDNA ORF Clone, Human, N-Myc tag HG16434-NM
JTV1 qPCR Primer Pairs, Human HP102756
info info
添加购物车成功! 添加购物车失败!