EMAP-II cDNA ORF Clone, Human, C-His tag

Cat: HG10623-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EMAP-II Reagents
CRO Services
Product recommended

All EMAP-II Reagents
EMAP-II cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
939 bp
Description
Full length Clone DNA of Human small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EMAP-II cDNA ORF Clone, Human, C-His tag Alternative Names
EMAP2 cDNA ORF Clone, Human;EMAPII cDNA ORF Clone, Human;HLD3 cDNA ORF Clone, Human;p43 cDNA ORF Clone, Human;SCYE1 cDNA ORF Clone, Human
EMAP-II Background Information

Aminoacyl tRNA synthase complex-interacting multifunctional protein 1, also known as Multisynthase complex auxiliary component p43, Endothelial monocyte-activating polypeptide II, AIMP1, EMAP2 and SCYE1, is a nucleus protein which contains one tRNA-binding domain. AIMP1 (also known as p43) is a factor associated with a macromolecular aminoacyl-tRNA synthetase (ARS) complex but also plays diverse regulatory roles in various physiological processes. AIMP1 negatively regulates TGF-beta signaling via stabilization of Smurf2. It suggests the novel activity of AIMP1 as a component of negative feedback loop of TGF-beta signaling. Recently, it been demonstrated that AIMP1 is also secreted and acts as a novel pleiotropic cytokine. AIMP1 protein induces the maturation and activation of DCs, which skew the immune response toward a Th1 response. AIMP1 is known as a cytokine working in the control of angiogenesis, inflammation, and wound healing. AIMP1 is secreted from the pancreas upon glucose starvation, and it also plays a glucagon-like role in glucose homeostasis. Although AIMP1 was identified as a component of the macromolecular aminoacyl tRNA synthetase complex involved in the cellular translation process, it was also found to be secreted as a cytokine having complex physiological functions. Among these, AIMP1's angiostatic and immune stimulating activities suggest its potential use as a novel antitumor therapeutic protein. AIMP1 may exert its antitumor activity by inducing tumor-suppressing cytokines. Thus, AIMP1 may be useful as a novel anti-tumor agent.

Full Name
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
References
  • Lee YS, et al. (2006) Antitumor activity of the novel human cytokine AIMP1 in an in vivo tumor model. Mol Cells. 21(2): 213-7.
  • Park SG, et al. (2006) Hormonal activity of AIMP1/p43 for glucose homeostasis. Proc Natl Acad Sci U S A. 103(40): 14913-8.
  • Kim E, et al. (2008) AIMP1/p43 protein induces the maturation of bone marrow-derived dendritic cells with T helper type 1-polarizing ability. J Immunol. 180(5): 2894-902.
  • Lee YS, et al. (2008) AIMP1/p43 downregulates TGF-beta signaling via stabilization of smurf2. Biochem Biophys Res Commun. 371(3): 395-400.
  • Han JM, et al. (2010) Antitumor activity and pharmacokinetic properties of ARS-interacting multi-functional protein 1 (AIMP1/p43). Cancer Lett. 287(2): 157-64.
  • EMAP-II cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EMAP-II cDNA ORF Clone in Cloning Vector, Rat RG83164-U
    EMAP-II cDNA ORF Clone, Rat, untagged RG83164-UT
    EMAP-II Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83164-ACGLN
    EMAP-II cDNA ORF Clone, Rat, C-GFPSpark® tag RG83164-ACG
    EMAP-II cDNA ORF Clone, Rat, N-GFPSpark® tag RG83164-ANG
    EMAP-II cDNA ORF Clone, Rat, C-OFPSpark® tag RG83164-ACR
    EMAP-II cDNA ORF Clone, Rat, N-OFPSpark® tag RG83164-ANR
    EMAP-II cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG83164-CF
    EMAP-II cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG83164-NF
    EMAP-II cDNA ORF Clone, Rat, C-His tag RG83164-CH
    EMAP-II cDNA ORF Clone, Rat, N-His tag RG83164-NH
    EMAP-II cDNA ORF Clone, Rat, C-HA tag RG83164-CY
    EMAP-II cDNA ORF Clone, Rat, N-HA tag RG83164-NY
    EMAP-II cDNA ORF Clone, Rat, C-Myc tag RG83164-CM
    EMAP-II cDNA ORF Clone, Rat, N-Myc tag RG83164-NM

    EMAP-II cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EMAP-II cDNA ORF Clone in Cloning Vector, Mouse MG50697-M
    EMAP-II cDNA ORF Clone, Mouse, untagged MG50697-UT
    EMAP-II cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50697-ACG
    EMAP-II Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50697-ACGLN
    EMAP-II cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50697-ANG
    EMAP-II cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50697-ACR
    EMAP-II cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50697-ANR
    EMAP-II cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50697-CF
    EMAP-II cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50697-NF
    EMAP-II cDNA ORF Clone, Mouse, C-His tag MG50697-CH
    EMAP-II cDNA ORF Clone, Mouse, N-His tag MG50697-NH
    EMAP-II cDNA ORF Clone, Mouse, C-HA tag MG50697-CY
    EMAP-II cDNA ORF Clone, Mouse, N-HA tag MG50697-NY
    EMAP-II cDNA ORF Clone, Mouse, C-Myc tag MG50697-CM
    EMAP-II cDNA ORF Clone, Mouse, N-Myc tag MG50697-NM
    EMAP-II qPCR Primer Pairs, Mouse MP200672

    EMAP-II cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EMAP-II cDNA ORF Clone in Cloning Vector, Human HG10623-M
    EMAP-II cDNA ORF Clone, Human, untagged HG10623-UT
    EMAP-II cDNA ORF Clone, Human, C-GFPSpark® tag HG10623-ACG
    EMAP-II Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10623-ACGLN
    EMAP-II cDNA ORF Clone, Human, N-GFPSpark® tag HG10623-ANG
    EMAP-II cDNA ORF Clone, Human, C-OFPSpark® tag HG10623-ACR
    EMAP-II cDNA ORF Clone, Human, N-OFPSpark® tag HG10623-ANR
    EMAP-II cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10623-CF
    EMAP-II cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10623-NF
    EMAP-II cDNA ORF Clone, Human, N-His tag HG10623-NH
    EMAP-II cDNA ORF Clone, Human, C-HA tag HG10623-CY
    EMAP-II cDNA ORF Clone, Human, N-HA tag HG10623-NY
    EMAP-II cDNA ORF Clone, Human, C-Myc tag HG10623-CM
    EMAP-II cDNA ORF Clone, Human, N-Myc tag HG10623-NM
    EMAP-II qPCR Primer Pairs, Human HP100603
    info info
    添加购物车成功! 添加购物车失败!