Iba1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14227-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Iba1 Reagents
CRO Services
Product recommended

All Iba1 Reagents
Iba1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human allograft inflammatory factor 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 0.49kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Iba1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Iba1 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
Iba1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
AIF-1 cDNA ORF Clone, Human;IBA1 cDNA ORF Clone, Human;IRT-1 cDNA ORF Clone, Human;IRT1 cDNA ORF Clone, Human
Iba1 Background Information

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Full Name
allograft inflammatory factor 1
References
  • Albertella M.R., et al.,(1994), Characterization of a novel gene in the human major histocompatibility complex that encodes a potential new member of the I kappa B family of proteins. Hum. Mol. Genet. 3:793-799.
  • Holzinger I., et al., (1995), Cloning and genomic characterization of LST1: a new gene in the human TNF region.Immunogenetics 42:315-322.
  • Autieri M.V., et al.,(1996), cDNA cloning of human allograft inflammatory factor-1: tissue distribution, cytokine induction, and mRNA expression in injured rat carotid arteries.Biochem. Biophys. Res. Commun. 228:29-37.
  • info info
    添加购物车成功! 添加购物车失败!