AHSP cDNA ORF Clone, Human, untagged

Cat: HG14391-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AHSP Reagents
CRO Services
Product recommended

All AHSP Reagents
AHSP cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
309 bp
Description
Full length Clone DNA of Human erythroid associated factor.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About AHSP
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AHSP cDNA ORF Clone, Human, untagged Alternative Names
EDRF cDNA ORF Clone, Human;ERAF cDNA ORF Clone, Human
AHSP Background Information

AHSP, also known as ERAF, is a conserved mammalian erythroid protein which belongs to the AHSP family. It is expressed in blood and bone marrow. AHSP facilitates the production of Hemoglobin A by stabilizing free α-globin. It rapidly binds to ferrous α with association (k'(AHSP)) and dissociation (k(AHSP)) rate constants of ≈10 μm(-1) s(-1) and 0.2 s(-1), respectively, at pH 7.4 at 22 ℃. A small slow phase was observed when AHSP binds to excess ferrous αCO. This slow phase appears to be due to cis to trans prolyl isomerization of the Asp(29)-Pro(30) peptide bond in wild-type AHSP because it was absent when αCO was mixed with P30A and P30W AHSP, which are fixed in the trans conformation. This slow phase was also absent when met(Fe(3+))-α reacted with wild-type AHSP, suggesting that met-α is capable of rapidly binding to either Pro(30) conformer. Both wild-type and Pro(30)-substituted AHSPs drive the formation of a met-α hemichrome conformation following binding to either met- or oxy(Fe(2+))-α. The dissociation rate of the met-α·AHSP complex (k(AHSP) ≈ 0.002 s(-1)) is ~100-fold slower than that for ferrous α·AHSP complexes, resulting in a much higher affinity of AHSP for met-α. Thus, in vivo, AHSP acts as a molecular chaperone by rapidly binding and stabilizing met-α hemichrome folding intermediates. The low rate of met-α dissociation also allows AHSP to have a quality control function by kinetically trapping ferric α and preventing its incorporation into less stable mixed valence Hemoglobin A tetramers. Reduction of AHSP-bound met-α allows more rapid release to β subunits to form stable fully, reduced hemoglobin dimers and tetramers.

Full Name
alpha hemoglobin stabilizing protein
References
  • Miele G., et al.,(2001), A novel erythroid-specific marker of transmissible spongiform encephalopathies. Nat. Med. 7:361-364.
  • Zhang Q.-H., et al., (2000), Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells.Genome Res. 10:1546-1560.
  • Kihm A.J., et al.,(2002), An abundant erythroid protein that stabilizes free alpha-haemoglobin.Nature 417:758-763.
  • info info
    添加购物车成功! 添加购物车失败!