After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AHSP / ERAF ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human AHSP cDNA Clone Product Information
NCBI RefSeq:BC035842
RefSeq ORF Size:309bp
cDNA Description:Full length Clone DNA of Homo sapiens erythroid associated factor with N terminal His tag.
Gene Synonym:EDRF, ERAF, AHSP
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

AHSP, also known as ERAF, is a conserved mammalian erythroid protein which belongs to the AHSP family. It is expressed in blood and bone marrow. AHSP facilitates the production of Hemoglobin A by stabilizing free α-globin. It rapidly binds to ferrous α with association (k'(AHSP)) and dissociation (k(AHSP)) rate constants of ≈10 μm(-1) s(-1) and 0.2 s(-1), respectively, at pH 7.4 at 22 ℃. A small slow phase was observed when AHSP binds to excess ferrous αCO. This slow phase appears to be due to cis to trans prolyl isomerization of the Asp(29)-Pro(30) peptide bond in wild-type AHSP because it was absent when αCO was mixed with P30A and P30W AHSP, which are fixed in the trans conformation. This slow phase was also absent when met(Fe(3+))-α reacted with wild-type AHSP, suggesting that met-α is capable of rapidly binding to either Pro(30) conformer. Both wild-type and Pro(30)-substituted AHSPs drive the formation of a met-α hemichrome conformation following binding to either met- or oxy(Fe(2+))-α. The dissociation rate of the met-α·AHSP complex (k(AHSP) ≈ 0.002 s(-1)) is ~100-fold slower than that for ferrous α·AHSP complexes, resulting in a much higher affinity of AHSP for met-α. Thus, in vivo, AHSP acts as a molecular chaperone by rapidly binding and stabilizing met-α hemichrome folding intermediates. The low rate of met-α dissociation also allows AHSP to have a quality control function by kinetically trapping ferric α and preventing its incorporation into less stable mixed valence Hemoglobin A tetramers. Reduction of AHSP-bound met-α allows more rapid release to β subunits to form stable fully, reduced hemoglobin dimers and tetramers.

Size / Price
Catalog: HG14391-NH
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"