Quick Order

Human Angiotensinogen/SerpinA8 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human AGT cDNA Clone Product Information
    NCBI RefSeq:NM_000029.3
    RefSeq ORF Size:1446bp
    cDNA Description:Full length Clone DNA of Homo sapiens angiotensinogen (serpin peptidase inhibitor, clade A, member 8) with C terminal Flag tag.
    Gene Synonym:ANHU, FLJ92595, FLJ97926, SERPINA8
    Species:Human
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AGT qPCR primers for gene expression analysis, HP100085 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Angiotensinogen, also known as AGT and SerpinA8, is a member of the serpin family. It is an α-2-globulin that is produced constitutively and released into the circulation mainly by the liver. Angiotensinogen is a essential component of the renin-angiotensin system (RAS) and a potent regulator of blood pressure. Angiotensinogen can be schematically considered to consist of a combination of an angiotensin I (Ang I) function, located at the N-terminal end, and the presence of a serpin (serine protease inhibitor) structure at the opposite end. Angiotensinogen is cleaved into three chains: Angiotensin-1 (Ang I), Angiotensin-2 (Ang II), and Angiotensin-3 (Ang III). Angiotensin-1 is a substrate of ACE (angiotensin converting enzyme) that removes a dipeptide to yield the physiologically active peptide angiotensin-2. Angiotensin-1 and angiotensin-2 can be further processed to generate angiotensin-3, angiotensin-4. Angiotensin 1-7 is cleaved from angiotensin-2 by ACE2. Angiotensin-2 acts directly on vascular smooth muscle as a potent vasoconstrictor, affects cardiac contractility and heart rate through its action on the sympathetic nervous system. Defects in AGT are associated with susceptibility to essential hypertension and renal tubular dysgenesis (RTD). Several serpins (antithrombin, maspin, pigment epithelial-derived factor, and kallistatin) have been recently shown to exert an antiangiogenic activity, suggesting a common mechanism of endothelial cell proliferation and migration. Angiotensinogen/AGT and its renin-cleaved product, des(Ang I)AGT, are also angiogenesis inhibitors, both in vitro and in vivo at concentrations within the range of those observed in plasma. The Angiotensinogen products, that is angiotensin II and possibly angiotensin II-related products, have been found to act locally in modulating adipose tissue growth in an autocrine/paracrine manner. The transient or chronic overexpression of angiotensinogen in adipose tissue favors lipogenesis in adipocytes and leads to a 'vicious' circle whereby adipose tissue development is further increased.

    References
  • Ailhaud G, et al. (2002) Angiotensinogen, adipocyte differentiation and fat mass enlargement. Curr Opin Clin Nutr Metab Care. 5(4): 385-9.
  • Corvol P, et al. (2003) Inhibition of angiogenesis: a new function for angiotensinogen and des(angiotensin I)angiotensinogen. Curr Hypertens Rep. 5(2): 149-54.
  • Size / Price
    Catalog: HG10994-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"