AGPAT3 cDNA ORF Clone, Human, N-HA tag

Cat: HG14746-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AGPAT3 Reagents
CRO Services
Product recommended

All AGPAT3 Reagents
AGPAT3 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1131 bp
Description
Full length Clone DNA of Human 1-acylglycerol-3-phosphate O-acyltransferase 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGPAT3 cDNA ORF Clone, Human, N-HA tag Alternative Names
LPAAT-GAMMA1 cDNA ORF Clone, Human;LPAAT3 cDNA ORF Clone, Human
AGPAT3 Background Information
Full Name
1-acylglycerol-3-phosphate O-acyltransferase 3

AGPAT3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AGPAT3 cDNA ORF Clone in Cloning Vector, Rat RG81702-U
AGPAT3 cDNA ORF Clone, Rat, untagged RG81702-UT
AGPAT3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81702-ACG
AGPAT3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81702-ACGLN
AGPAT3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81702-ACR
AGPAT3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81702-CF
AGPAT3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81702-NF
AGPAT3 cDNA ORF Clone, Rat, C-His tag RG81702-CH
AGPAT3 cDNA ORF Clone, Rat, N-His tag RG81702-NH
AGPAT3 cDNA ORF Clone, Rat, C-HA tag RG81702-CY
AGPAT3 cDNA ORF Clone, Rat, N-HA tag RG81702-NY
AGPAT3 cDNA ORF Clone, Rat, C-Myc tag RG81702-CM
AGPAT3 cDNA ORF Clone, Rat, N-Myc tag RG81702-NM

AGPAT3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AGPAT3 cDNA ORF Clone in Cloning Vector, Mouse MG52361-G
AGPAT3 cDNA ORF Clone, Mouse, untagged MG52361-UT
AGPAT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52361-ACG
AGPAT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52361-ACGLN
AGPAT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52361-ACR
AGPAT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52361-CF
AGPAT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52361-NF
AGPAT3 cDNA ORF Clone, Mouse, C-His tag MG52361-CH
AGPAT3 cDNA ORF Clone, Mouse, N-His tag MG52361-NH
AGPAT3 cDNA ORF Clone, Mouse, C-HA tag MG52361-CY
AGPAT3 cDNA ORF Clone, Mouse, N-HA tag MG52361-NY
AGPAT3 cDNA ORF Clone, Mouse, C-Myc tag MG52361-CM
AGPAT3 cDNA ORF Clone, Mouse, N-Myc tag MG52361-NM
AGPAT3 qPCR Primer Pairs, Mouse MP202234

AGPAT3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AGPAT3 cDNA ORF Clone in Cloning Vector, Human HG14746-G
AGPAT3 cDNA ORF Clone, Human, untagged HG14746-UT
AGPAT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14746-ACG
AGPAT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14746-ACGLN
AGPAT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14746-ACR
AGPAT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14746-CF
AGPAT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14746-NF
AGPAT3 cDNA ORF Clone, Human, C-His tag HG14746-CH
AGPAT3 cDNA ORF Clone, Human, N-His tag HG14746-NH
AGPAT3 cDNA ORF Clone, Human, C-HA tag HG14746-CY
AGPAT3 cDNA ORF Clone, Human, C-Myc tag HG14746-CM
AGPAT3 cDNA ORF Clone, Human, N-Myc tag HG14746-NM
AGPAT3 qPCR Primer Pairs, Human HP103379
info info
添加购物车成功! 添加购物车失败!