Argonaute-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11079-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Argonaute-2 Reagents
CRO Services
Product recommended

All Argonaute-2 Reagents
Argonaute-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2580 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 9G>A not causing the amino acid variation.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2C, 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + XbaI (6kb + 2.62kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Argonaute-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Argonaute-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
Human AGO2/Argonaute 2/EIF2C2 Gene Expression validated Image 14290
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Argonaute-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
Argonaute 2 cDNA ORF Clone, Human;EIF2C2 cDNA ORF Clone, Human;Q10 cDNA ORF Clone, Human
Argonaute-2 Background Information

Argonaute 2 (AGO2), also known as Eukaryotic translation initiation factor 2C2 (EIF2C2), belongs to the Argonaute family, AGO subfamily, which is a component of the RNA-induced silencing complex (RISC) and mediates small interfering RNA (siRNA)-directed mRNA cleavage and microRNA translational suppression. AGO2 protein is the catalytic engine of mammalian RNAi. It contains a PIWI domain that is structurally related to RNases H and possibly shares with them a two-metal-ion catalysis mechanism. Human AGO2 was unable to cleave preformed RNA duplexes and exhibited weaker binding affinity for RNA duplexes compared with the single strand RNA. The enzyme exhibited greater RNase H activity in the presence of Mn2+ compared with Mg2+. Human AGO2 exhibited weaker binding affinities and reduced cleavage activities for antisense RNAs with either a 5'-terminal hydroxyl or abasic nucleotide. In mouse hematopoiesis, AGO2 controls early development of lymphoid and erythroid cells. AGO2 is a highly specialized member of the Argonaute family with an essential nonredundant Slicer-independent function within the mammalian miRNA pathway. AGO2 regulates dFMR1 expression, and the relationship between dFMR1 and AGO2 was defined by their physical interaction and co-regulation of downstream targets. AGO2 and dFMR1 are also connected through a regulatory relationship. AGO2 is a regulator of dFMR1 expression and have clarified an important developmental role for AGO2 in the nervous system and germ line that requires dFMR1 function. In addition, AGO2 is regulated at both the transcriptional and posttranslational level, and also implicate AGO2 and enhanced micro-RNA activity in the tumorigenic progression of breast cancer cell lines.

Full Name
argonaute RISC catalytic component 2
References
  • O'Carroll D, et al. (2007) A Slicer-independent role for Argonaute 2 in hematopoiesis and the microRNA pathway. Genes Dev. 21(16): 1999-2004.
  • Pepper AS, et al. (2009) Argonaute2 suppresses Drosophila fragile X expression preventing neurogenesis and oogenesis defects. PLoS One. 4(10): e7618.
  • Lima WF, et al. (2009) Binding and cleavage specificities of human Argonaute2. J Biol Chem. 284(38): 26017-28.
  • Adams BD, et al. (2009) Argonaute-2 expression is regulated by epidermal growth factor receptor and mitogen-activated protein kinase signaling and correlates with a transformed phenotype in breast cancer cells. Endocrinology. 150(1): 14-23.
  • Salvatore V, et al. (2010) Bacterial expression of mouse argonaute 2 for functional and mutational studies. Int J Mol Sci. 11(2): 745-53.
  • Wilson JA, et al. (2011) Human Ago2 is required for efficient microRNA 122 regulation of hepatitis C virus RNA accumulation and translation. J Virol. 85(5): 2342-50.
  • Argonaute-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Argonaute-2 cDNA ORF Clone in Cloning Vector, Mouse MG50683-M
    Argonaute-2 cDNA ORF Clone, Mouse, untagged MG50683-UT
    Argonaute-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50683-ACGLN
    Argonaute-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50683-ACG
    Argonaute-2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50683-ANG
    Argonaute-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50683-ACR
    Argonaute-2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50683-ANR
    Argonaute-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50683-CF
    Argonaute-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50683-NF
    Argonaute-2 cDNA ORF Clone, Mouse, C-His tag MG50683-CH
    Argonaute-2 cDNA ORF Clone, Mouse, N-His tag MG50683-NH
    Argonaute-2 cDNA ORF Clone, Mouse, C-HA tag MG50683-CY
    Argonaute-2 cDNA ORF Clone, Mouse, N-HA tag MG50683-NY
    Argonaute-2 cDNA ORF Clone, Mouse, C-Myc tag MG50683-CM
    Argonaute-2 cDNA ORF Clone, Mouse, N-Myc tag MG50683-NM
    Argonaute-2 qPCR Primer Pairs, Mouse MP200661

    Argonaute-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Argonaute-2 cDNA ORF Clone in Cloning Vector, Human HG11079-M
    Argonaute-2 cDNA ORF Clone, Human, untagged HG11079-UT
    Argonaute-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11079-ACGLN
    Argonaute-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11079-ACG
    Argonaute-2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11079-ANG
    Argonaute-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11079-ACR
    Argonaute-2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11079-ANR
    Argonaute-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11079-NF
    Argonaute-2 cDNA ORF Clone, Human, C-His tag HG11079-CH
    Argonaute-2 cDNA ORF Clone, Human, N-His tag HG11079-NH
    Argonaute-2 cDNA ORF Clone, Human, C-HA tag HG11079-CY
    Argonaute-2 cDNA ORF Clone, Human, N-HA tag HG11079-NY
    Argonaute-2 cDNA ORF Clone, Human, C-Myc tag HG11079-CM
    Argonaute-2 cDNA ORF Clone, Human, N-Myc tag HG11079-NM
    Argonaute-2 qPCR Primer Pairs, Human HP101001
    info info
    添加购物车成功! 添加购物车失败!