AGO1 cDNA ORF Clone, Human, C-HA tag

Cat: HG11225-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AGO1 Reagents
CRO Services
Product recommended

All AGO1 Reagents
AGO1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2574 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2C, 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGO1 cDNA ORF Clone, Human, C-HA tag Alternative Names
EIF2C cDNA ORF Clone, Human;EIF2C1 cDNA ORF Clone, Human;GERP95 cDNA ORF Clone, Human;Q99 cDNA ORF Clone, Human
AGO1 Background Information

Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of the argonaute family and ago subfamily. Protein argonaute-1 in humans is encoded by the EIF2C1 gene. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. This genomic region is frequently lost in human cancers such as Wilms tumors, neuroblastoma, and carcinomas of the breast, liver, and colon. The human EIF2C1 gene is ubiquitously expressed at low to medium levels. Differential polyadenylation and splicing result in a complex transcriptional pattern. EIF2C1 protein contains one PAZ domain and one Piwi domain. It is required for RNA-mediated gene silencing (RNAi) and transcriptional gene silencing (TGS) of promoter regions which are complementary to bound short antigene RNAs (agRNAs). EIF2C1 binds to short RNAs such as microRNAs (miRNAs) or short interfering RNAs (siRNAs), and represses the translation of mRNAs which are complementary to them.

Full Name
argonaute RISC catalytic component 1
References
  • Koesters R., et al.,(1999), Human eukaryotic initiation factor EIF2C1 gene: cDNA sequence, genomic organization, localization to chromosomal bands 1p34-p35, and expression. Genomics 61:210-218.
  • Gregory S.G., et al., (2006), The DNA sequence and biological annotation of human chromosome 1.Nature 441:315-321.
  • Motamedi M.R., et al.,(2004), Two RNAi complexes, RITS and RDRC, physically interact and localize to noncoding centromeric RNAs. Cell. 119:789-802.
  • info info
    添加购物车成功! 添加购物车失败!