After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AGO1 / Argonaute 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human AGO1 cDNA Clone Product Information
NCBI RefSeq:NM_012199.2
RefSeq ORF Size:2574bp
cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2C, 1.
Gene Synonym:Q99, AGO1, EIF2C, GERP95, DKFZp686M13167, EIF2C1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-EIF2C1
Restriction Site:KpnI + XbaI (6.1kb + 2.57kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human AGO1 Gene Plasmid Map
Human AGO1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of the argonaute family and ago subfamily. Protein argonaute-1 in humans is encoded by the EIF2C1 gene. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. This genomic region is frequently lost in human cancers such as Wilms tumors, neuroblastoma, and carcinomas of the breast, liver, and colon. The human EIF2C1 gene is ubiquitously expressed at low to medium levels. Differential polyadenylation and splicing result in a complex transcriptional pattern. EIF2C1 protein contains one PAZ domain and one Piwi domain. It is required for RNA-mediated gene silencing (RNAi) and transcriptional gene silencing (TGS) of promoter regions which are complementary to bound short antigene RNAs (agRNAs). EIF2C1 binds to short RNAs such as microRNAs (miRNAs) or short interfering RNAs (siRNAs), and represses the translation of mRNAs which are complementary to them.

Size / Price
Catalog: HG11225-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human AGO1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"