AGMAT/Agmatinase cDNA ORF Clone, Human, untagged

Cat: HG15539-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AGMAT/Agmatinase Reagents
CRO Services
Product recommended

All AGMAT/Agmatinase Reagents
AGMAT/Agmatinase cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1059 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human agmatine ureohydrolase (agmatinase).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+1.06kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
AGMAT/Agmatinase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGMAT/Agmatinase cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
AGMAT/Agmatinase Background Information
Full Name
agmatine ureohydrolase (agmatinase)

AGMAT/Agmatinase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AGMAT/Agmatinase cDNA ORF Clone in Cloning Vector, Mouse MG55251-U
AGMAT/Agmatinase cDNA ORF Clone, Mouse, untagged MG55251-UT
AGMAT/Agmatinase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55251-ACGLN
AGMAT/Agmatinase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55251-ACG
AGMAT/Agmatinase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG55251-ANG
AGMAT/Agmatinase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55251-ACR
AGMAT/Agmatinase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG55251-ANR
AGMAT/Agmatinase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55251-CF
AGMAT/Agmatinase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55251-NF
AGMAT/Agmatinase cDNA ORF Clone, Mouse, C-His tag MG55251-CH
AGMAT/Agmatinase cDNA ORF Clone, Mouse, N-His tag MG55251-NH
AGMAT/Agmatinase cDNA ORF Clone, Mouse, C-HA tag MG55251-CY
AGMAT/Agmatinase cDNA ORF Clone, Mouse, N-HA tag MG55251-NY
AGMAT/Agmatinase cDNA ORF Clone, Mouse, C-Myc tag MG55251-CM
AGMAT/Agmatinase cDNA ORF Clone, Mouse, N-Myc tag MG55251-NM

AGMAT/Agmatinase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AGMAT/Agmatinase cDNA ORF Clone in Cloning Vector, Human HG15539-G
AGMAT/Agmatinase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15539-ACGLN
AGMAT/Agmatinase cDNA ORF Clone, Human, C-GFPSpark® tag HG15539-ACG
AGMAT/Agmatinase cDNA ORF Clone, Human, N-GFPSpark® tag HG15539-ANG
AGMAT/Agmatinase cDNA ORF Clone, Human, C-OFPSpark® tag HG15539-ACR
AGMAT/Agmatinase cDNA ORF Clone, Human, N-OFPSpark® tag HG15539-ANR
AGMAT/Agmatinase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15539-CF
AGMAT/Agmatinase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15539-NF
AGMAT/Agmatinase cDNA ORF Clone, Human, C-His tag HG15539-CH
AGMAT/Agmatinase cDNA ORF Clone, Human, N-His tag HG15539-NH
AGMAT/Agmatinase cDNA ORF Clone, Human, C-HA tag HG15539-CY
AGMAT/Agmatinase cDNA ORF Clone, Human, N-HA tag HG15539-NY
AGMAT/Agmatinase cDNA ORF Clone, Human, C-Myc tag HG15539-CM
AGMAT/Agmatinase cDNA ORF Clone, Human, N-Myc tag HG15539-NM
AGMAT/Agmatinase qPCR Primer Pairs, Human HP104160
info info
添加购物车成功! 添加购物车失败!