Alpha-fetoprotein cDNA ORF Clone, Human, C-His tag

Cat: HG12177-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Alpha-fetoprotein Reagents
CRO Services
Product recommended

All Alpha-fetoprotein Reagents
Alpha-fetoprotein cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1830 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human alpha-fetoprotein with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI (6kb + 1.88kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Alpha-fetoprotein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Alpha-fetoprotein cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
Alpha-fetoprotein cDNA ORF Clone, Human, C-His tag Alternative Names
AFPD cDNA ORF Clone, Human;Alpha-fetoprotein cDNA ORF Clone, Human;FETA cDNA ORF Clone, Human;HPAFP cDNA ORF Clone, Human
Alpha-fetoprotein Background Information

Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D (Gc) protein, and alpha-albumin. AFP is a glycoprotein of 591 amino acids and a carbohydrate moiety. AFP is one of the several embryo-specific proteins and is a dominant serum protein as early in human embryonic life as one month, when albumin and transferrin are present in relatively small amounts. It is first synthesized in the human by the yolk sac and liver(1-2 months) and subsequently predominantly in the liver. A small amount of AFP is produced by the GI tract of the human conceptus. It has been proved that AFP may reappear in the serum in elevated amounts in adult life in association with normal restorative processes and with malignant growth. Alpha-fetoprotein (AFP) is a specific marker for hepatocellular carcinoma (HCC), teratoblastomas, and neural tube defect (NTD).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
alpha-fetoprotein
References
  • Mizejewski GJ. (2001) Alpha-fetoprotein Structure and Function: Relevance to Isoforms, Epitopes, and Conformational Variants. Exp Biol Med. 226(5): 377-408.
  • Tomasi TB, et al. (1977) Structure and Function of Alpha-Fetoprotein. Annual Review of Medicine. 28: 453-65.
  • Leguy MC, et al. (2011) Assessment of AFP in amniotic fluid: comparison of three automated techniques. Ann Biol Clin. 69(4): 441-6.
  • Alpha-fetoprotein cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Alpha-fetoprotein cDNA ORF Clone in Cloning Vector, Rat RG82235-U
    Alpha-fetoprotein Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82235-ACGLN

    Alpha-fetoprotein cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Alpha-fetoprotein cDNA ORF Clone in Cloning Vector, Mouse MG52903-G
    Alpha-fetoprotein cDNA ORF Clone, Mouse, untagged MG52903-UT
    Alpha-fetoprotein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52903-ACGLN
    Alpha-fetoprotein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52903-ACG
    Alpha-fetoprotein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52903-ACR
    Alpha-fetoprotein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52903-CF
    Alpha-fetoprotein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52903-NF
    Alpha-fetoprotein cDNA ORF Clone, Mouse, C-His tag MG52903-CH
    Alpha-fetoprotein cDNA ORF Clone, Mouse, N-His tag MG52903-NH
    Alpha-fetoprotein cDNA ORF Clone, Mouse, C-HA tag MG52903-CY
    Alpha-fetoprotein cDNA ORF Clone, Mouse, N-HA tag MG52903-NY
    Alpha-fetoprotein cDNA ORF Clone, Mouse, C-Myc tag MG52903-CM
    Alpha-fetoprotein cDNA ORF Clone, Mouse, N-Myc tag MG52903-NM

    Alpha-fetoprotein cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Alpha-fetoprotein cDNA ORF Clone in Cloning Vector, Human HG12177-G
    Alpha-fetoprotein cDNA ORF Clone, Human, untagged HG12177-UT
    Alpha-fetoprotein cDNA ORF Clone, Human, C-GFPSpark® tag HG12177-ACG
    Alpha-fetoprotein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12177-ACGLN
    Alpha-fetoprotein cDNA ORF Clone, Human, C-OFPSpark® tag HG12177-ACR
    Alpha-fetoprotein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12177-CF
    Alpha-fetoprotein cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12177-NF
    Alpha-fetoprotein cDNA ORF Clone, Human, N-His tag HG12177-NH
    Alpha-fetoprotein cDNA ORF Clone, Human, C-HA tag HG12177-CY
    Alpha-fetoprotein cDNA ORF Clone, Human, N-HA tag HG12177-NY
    Alpha-fetoprotein cDNA ORF Clone, Human, C-Myc tag HG12177-CM
    Alpha-fetoprotein cDNA ORF Clone, Human, N-Myc tag HG12177-NM
    Alpha-fetoprotein qPCR Primer Pairs, Human HP100076
    info info
    添加购物车成功! 添加购物车失败!