AFMID cDNA ORF Clone, Human, C-His tag

Cat: HG15883-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AFMID Reagents
CRO Services
Product recommended

All AFMID Reagents
AFMID cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
912 bp
Description
Full length Clone DNA of Human arylformamidase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AFMID cDNA ORF Clone, Human, C-His tag Alternative Names
FKF cDNA ORF Clone, Human;KF cDNA ORF Clone, Human;KFA cDNA ORF Clone, Human
AFMID Background Information
Full Name
arylformamidase

AFMID cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AFMID cDNA ORF Clone in Cloning Vector, Mouse MG53275-U
AFMID cDNA ORF Clone, Mouse, untagged MG53275-UT
AFMID cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53275-ACG
AFMID Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53275-ACGLN
AFMID cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53275-ANG
AFMID cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53275-ACR
AFMID cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53275-ANR
AFMID cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53275-CF
AFMID cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53275-NF
AFMID cDNA ORF Clone, Mouse, C-His tag MG53275-CH
AFMID cDNA ORF Clone, Mouse, N-His tag MG53275-NH
AFMID cDNA ORF Clone, Mouse, C-HA tag MG53275-CY
AFMID cDNA ORF Clone, Mouse, N-HA tag MG53275-NY
AFMID cDNA ORF Clone, Mouse, C-Myc tag MG53275-CM
AFMID cDNA ORF Clone, Mouse, N-Myc tag MG53275-NM

AFMID cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AFMID cDNA ORF Clone in Cloning Vector, Human HG15883-G
AFMID cDNA ORF Clone, Human, untagged HG15883-UT
AFMID cDNA ORF Clone, Human, C-GFPSpark® tag HG15883-ACG
AFMID Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15883-ACGLN
AFMID cDNA ORF Clone, Human, N-GFPSpark® tag HG15883-ANG
AFMID cDNA ORF Clone, Human, C-OFPSpark® tag HG15883-ACR
AFMID cDNA ORF Clone, Human, N-OFPSpark® tag HG15883-ANR
AFMID cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15883-CF
AFMID cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15883-NF
AFMID cDNA ORF Clone, Human, N-His tag HG15883-NH
AFMID cDNA ORF Clone, Human, C-HA tag HG15883-CY
AFMID cDNA ORF Clone, Human, N-HA tag HG15883-NY
AFMID cDNA ORF Clone, Human, C-Myc tag HG15883-CM
AFMID cDNA ORF Clone, Human, N-Myc tag HG15883-NM
AFMID qPCR Primer Pairs, Human HP104472
info info
添加购物车成功! 添加购物车失败!