AFM cDNA ORF Clone, Human, N-Myc tag

Cat: HG13231-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AFM Reagents
CRO Services
Product recommended

All AFM Reagents
AFM cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1800 bp
Description
Full length Clone DNA of Human afamin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AFM cDNA ORF Clone, Human, N-Myc tag Alternative Names
ALB2 cDNA ORF Clone, Human;ALBA cDNA ORF Clone, Human;ALF cDNA ORF Clone, Human
AFM Background Information
Full Name
afamin

AFM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AFM cDNA ORF Clone in Cloning Vector, Mouse MG5A3376-U
AFM cDNA ORF Clone, Mouse, untagged MG5A3376-UT
AFM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3376-ACGLN
AFM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3376-ACG
AFM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3376-ACR
AFM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3376-CF
AFM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3376-NF
AFM cDNA ORF Clone, Mouse, C-His tag MG5A3376-CH
AFM cDNA ORF Clone, Mouse, N-His tag MG5A3376-NH
AFM cDNA ORF Clone, Mouse, C-HA tag MG5A3376-CY
AFM cDNA ORF Clone, Mouse, N-HA tag MG5A3376-NY
AFM cDNA ORF Clone, Mouse, C-Myc tag MG5A3376-CM
AFM cDNA ORF Clone, Mouse, N-Myc tag MG5A3376-NM

AFM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AFM cDNA ORF Clone in Cloning Vector, Human HG13231-G
AFM cDNA ORF Clone, Human, untagged HG13231-UT
AFM cDNA ORF Clone, Human, C-GFPSpark® tag HG13231-ACG
AFM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13231-ACGLN
AFM cDNA ORF Clone, Human, C-OFPSpark® tag HG13231-ACR
AFM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13231-CF
AFM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13231-NF
AFM cDNA ORF Clone, Human, C-His tag HG13231-CH
AFM cDNA ORF Clone, Human, N-His tag HG13231-NH
AFM cDNA ORF Clone, Human, C-HA tag HG13231-CY
AFM cDNA ORF Clone, Human, N-HA tag HG13231-NY
AFM cDNA ORF Clone, Human, C-Myc tag HG13231-CM
AFM qPCR Primer Pairs, Human HP103198
info info
添加购物车成功! 添加购物车失败!