Quick Order

Human ADSL / Adenylosuccinate Lyase Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human ADSL cDNA Clone Product Information
    NCBI RefSeq:NM_000026
    RefSeq ORF Size:1455bp
    cDNA Description:Full length Clone DNA of Homo sapiens adenylosuccinate lyase.
    Gene Synonym:ASL, AMPS, ASASE, ADSL
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ADSL qPCR primers for gene expression analysis, HP101165 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Human ADSL / Adenylosuccinate Lyase Gene ORF cDNA clone expression plasmid on other vectors
    Product nameProduct name
    Background

    Adenylosuccinate lyase, also known as adenylosuccinase, ADSL or ASL, is an enzyme implicated in the reaction of adenylosuccinat converting to AMP and fumarate as part of the purine nucleotide cycle. The two substates of adenylosuccinate lyase (ADSL) are dephosphorylated derivatives of SAICA ribotide (SAICAR) and adenylosuccinate (S-AMP), which catalyzes an important reaction in the de novo pathway of purine biosynthesis. ADSL catalyzes two distinct reactions in the synthesis of purine nucleotides, both of which involve the _-elimination of fumarate to produce either aminoimidazole carboxamide ribotide from SAICAR or AMP from S-AMP. The Adenylosuccinate lyase deficiency is a rare autosomal recessive metabolic disorder characterized by the present of SAICA riboside and succinyladenosine (S-Ado). ADSL defect in different patients is often caused by different mutations to the enzyme.

    References
  • Nassogne M, et al. (2000) Adenylosuccinase deficiency: an unusual cause of early-onset epilepsy associated with acquired microcephaly. Brain and development. 22 (6): 383-6.
  • Sivendran S, et al. (2004) Two novel mutant human adenylosuccinate lyases (ASLs) associated with autism and characterization of the equivalent mutant Bacillus subtilis ASL. J Biol Chem. 279 (51): 53789-97.
  • Lee TT, et al. (1999) His68 and His141 are critical contributors to the intersubunit catalytic site of adenylosuccinate lyase of Bacillus subtilis. Biochemistry. 38 (1): 22-32.
  • Size / Price
    Catalog: HG11287-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"