ADRB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10378-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADRB2 Reagents
CRO Services
Product recommended

All ADRB2 Reagents
ADRB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1242 bp
Description
Full length Clone DNA of Human adrenergic, beta-2-, receptor, surface
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADRB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human ADRB2 Gene Expression validated Image 1517
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
ADRB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ADRB2R cDNA ORF Clone, Human;ADRBR cDNA ORF Clone, Human;B2AR cDNA ORF Clone, Human;BAR cDNA ORF Clone, Human;BETA2AR cDNA ORF Clone, Human
ADRB2 Background Information
Full Name
adrenoceptor beta 2, surface

ADRB2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ADRB2 cDNA ORF Clone in Cloning Vector, Rat RG81492-G

ADRB2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADRB2 cDNA ORF Clone in Cloning Vector, Mouse MG57153-U
ADRB2 cDNA ORF Clone, Mouse, untagged MG57153-UT
ADRB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57153-ACGLN
ADRB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57153-ACG
ADRB2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57153-ANG
ADRB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57153-ACR
ADRB2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57153-ANR
ADRB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57153-CF
ADRB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57153-NF
ADRB2 cDNA ORF Clone, Mouse, C-His tag MG57153-CH
ADRB2 cDNA ORF Clone, Mouse, N-His tag MG57153-NH
ADRB2 cDNA ORF Clone, Mouse, C-HA tag MG57153-CY
ADRB2 cDNA ORF Clone, Mouse, N-HA tag MG57153-NY
ADRB2 cDNA ORF Clone, Mouse, C-Myc tag MG57153-CM
ADRB2 cDNA ORF Clone, Mouse, N-Myc tag MG57153-NM

ADRB2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADRB2 cDNA ORF Clone in Cloning Vector, Human HG10378-G
ADRB2 cDNA ORF Clone, Human, untagged HG10378-UT
ADRB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10378-ACGLN
ADRB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10378-ACG
ADRB2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10378-ANG
ADRB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10378-ACR
ADRB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10378-NF
ADRB2 cDNA ORF Clone, Human, C-His tag HG10378-CH
ADRB2 cDNA ORF Clone, Human, N-His tag HG10378-NH
ADRB2 cDNA ORF Clone, Human, C-HA tag HG10378-CY
ADRB2 cDNA ORF Clone, Human, N-HA tag HG10378-NY
ADRB2 cDNA ORF Clone, Human, C-Myc tag HG10378-CM
ADRB2 cDNA ORF Clone, Human, N-Myc tag HG10378-NM
ADRB2 qPCR Primer Pairs, Human HP100413
info info
添加购物车成功! 添加购物车失败!