Adenosine Receptor A2a cDNA ORF Clone, Human, C-Myc tag

Cat: HG12307-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Adenosine Receptor A2a Reagents
CRO Services
Product recommended

All Adenosine Receptor A2a Reagents
Adenosine Receptor A2a cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human adenosine A2a receptor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 1.2kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Adenosine Receptor A2a cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Adenosine Receptor A2a cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
Adenosine Receptor A2a cDNA ORF Clone, Human, C-Myc tag Alternative Names
A2aR cDNA ORF Clone, Human;ADORA2 cDNA ORF Clone, Human;RDC8 cDNA ORF Clone, Human
Adenosine Receptor A2a Background Information

This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding.

Immune Checkpoint
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
adenosine A2a receptor
References
  • Alchera E, Imarisio C, Mandili G, et al. Pharmacological Preconditioning by Adenosine A2a Receptor Stimulation: Features of the Protected Liver Cell Phenotype. BioMed Research International. 2015;2015:286746.
  • Adenosine Receptor A2a cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Adenosine Receptor A2a cDNA ORF Clone in Cloning Vector, Mouse MG52586-G
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, untagged MG52586-UT
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52586-ACG
    Adenosine Receptor A2a Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52586-ACGLN
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52586-ACR
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52586-CF
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52586-NF
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, C-His tag MG52586-CH
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, N-His tag MG52586-NH
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, C-HA tag MG52586-CY
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, N-HA tag MG52586-NY
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, C-Myc tag MG52586-CM
    Adenosine Receptor A2a cDNA ORF Clone, Mouse, N-Myc tag MG52586-NM
    Adenosine Receptor A2a qPCR Primer Pairs, Mouse MP202457

    Adenosine Receptor A2a cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Adenosine Receptor A2a cDNA ORF Clone in Cloning Vector, Human HG12307-G
    Adenosine Receptor A2a cDNA ORF Clone, Human, untagged HG12307-UT
    Adenosine Receptor A2a cDNA ORF Clone, Human, C-GFPSpark® tag HG12307-ACG
    Adenosine Receptor A2a Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12307-ACGLN
    Adenosine Receptor A2a cDNA ORF Clone, Human, N-GFPSpark® tag HG12307-ANG
    Adenosine Receptor A2a cDNA ORF Clone, Human, C-OFPSpark® tag HG12307-ACR
    Adenosine Receptor A2a cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12307-CF
    Adenosine Receptor A2a cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12307-NF
    Adenosine Receptor A2a cDNA ORF Clone, Human, C-His tag HG12307-CH
    Adenosine Receptor A2a cDNA ORF Clone, Human, N-His tag HG12307-NH
    Adenosine Receptor A2a cDNA ORF Clone, Human, C-HA tag HG12307-CY
    Adenosine Receptor A2a cDNA ORF Clone, Human, N-HA tag HG12307-NY
    Adenosine Receptor A2a cDNA ORF Clone, Human, N-Myc tag HG12307-NM
    Adenosine Receptor A2a qPCR Primer Pairs, Human HP101912
    info info
    添加购物车成功! 添加购物车失败!