Adiponectin Receptor 1 cDNA ORF Clone, Human, C-HA tag

Cat: HG14109-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Adiponectin Receptor 1 Reagents
CRO Services
Product recommended

All Adiponectin Receptor 1 Reagents
Adiponectin Receptor 1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1170 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human adiponectin receptor 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+1.17kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Adiponectin Receptor 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Adiponectin Receptor 1 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
Adiponectin Receptor 1 cDNA ORF Clone, Human, C-HA tag Alternative Names
ACDCR1 cDNA ORF Clone, Human;CGI-45 cDNA ORF Clone, Human;CGI45 cDNA ORF Clone, Human;PAQR1 cDNA ORF Clone, Human;TESBP1A cDNA ORF Clone, Human
Adiponectin Receptor 1 Background Information
Full Name
adiponectin receptor 1

Adiponectin Receptor 1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 1 cDNA ORF Clone in Cloning Vector, Canine DG70118-G

Adiponectin Receptor 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 1 cDNA ORF Clone in Cloning Vector, Rat RG81075-G

Adiponectin Receptor 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 1 cDNA ORF Clone in Cloning Vector, Mouse MG53873-U
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, untagged MG53873-UT
Adiponectin Receptor 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53873-ACGLN
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53873-ACG
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53873-ACR
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53873-CF
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53873-NF
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, C-His tag MG53873-CH
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, N-His tag MG53873-NH
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, C-HA tag MG53873-CY
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, N-HA tag MG53873-NY
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, C-Myc tag MG53873-CM
Adiponectin Receptor 1 cDNA ORF Clone, Mouse, N-Myc tag MG53873-NM

Adiponectin Receptor 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 1 cDNA ORF Clone in Cloning Vector, Human HG14109-G
Adiponectin Receptor 1 cDNA ORF Clone, Human, untagged HG14109-UT
Adiponectin Receptor 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14109-ACGLN
Adiponectin Receptor 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14109-ACG
Adiponectin Receptor 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14109-ACR
Adiponectin Receptor 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14109-CF
Adiponectin Receptor 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14109-NF
Adiponectin Receptor 1 cDNA ORF Clone, Human, C-His tag HG14109-CH
Adiponectin Receptor 1 cDNA ORF Clone, Human, N-His tag HG14109-NH
Adiponectin Receptor 1 cDNA ORF Clone, Human, N-HA tag HG14109-NY
Adiponectin Receptor 1 cDNA ORF Clone, Human, C-Myc tag HG14109-CM
Adiponectin Receptor 1 cDNA ORF Clone, Human, N-Myc tag HG14109-NM
Adiponectin Receptor 1 qPCR Primer Pairs, Human HP102762
info info
添加购物车成功! 添加购物车失败!