Text Size:AAA

Human alcohol dehydrogenase 1A/ADH1A Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human ADH1A cDNA Clone Product Information
    NCBI RefSeq:BC117442
    RefSeq ORF Size:1128bp
    cDNA Description:Full length Clone DNA of Homo sapiens alcohol dehydrogenase 1A (class I), alpha polypeptide.
    Gene Synonym:ADH1
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ADH1A qPCR primers for gene expression analysis, HP102595 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Human alcohol dehydrogenase 1A/ADH1A Gene ORF cDNA clone expression plasmid on other vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"