ADCK4 cDNA ORF Clone, Human, C-His tag

Cat: HG12173-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ADCK4 Reagents
CRO Services
Product recommended

All ADCK4 Reagents
ADCK4 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1635 bp
Description
Full length Clone DNA of Human aarF domain containing kinase 4 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADCK4 cDNA ORF Clone, Human, C-His tag Alternative Names
NPHS9 cDNA ORF Clone, Human
ADCK4 Background Information
Full Name
aarF domain containing kinase 4

ADCK4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ADCK4 cDNA ORF Clone in Cloning Vector, Rhesus CG90416-G
ADCK4 cDNA ORF Clone, Rhesus, untagged CG90416-UT
ADCK4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90416-ACGLN
ADCK4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90416-ACG
ADCK4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90416-ACR
ADCK4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90416-CF
ADCK4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90416-NF
ADCK4 cDNA ORF Clone, Rhesus, C-His tag CG90416-CH
ADCK4 cDNA ORF Clone, Rhesus, N-His tag CG90416-NH
ADCK4 cDNA ORF Clone, Rhesus, C-HA tag CG90416-CY
ADCK4 cDNA ORF Clone, Rhesus, N-HA tag CG90416-NY
ADCK4 cDNA ORF Clone, Rhesus, C-Myc tag CG90416-CM
ADCK4 cDNA ORF Clone, Rhesus, N-Myc tag CG90416-NM

ADCK4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADCK4 cDNA ORF Clone in Cloning Vector, Human HG12173-G
ADCK4 cDNA ORF Clone, Human, untagged HG12173-UT
ADCK4 cDNA ORF Clone, Human, C-GFPSpark® tag HG12173-ACG
ADCK4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12173-ACGLN
ADCK4 cDNA ORF Clone, Human, C-OFPSpark® tag HG12173-ACR
ADCK4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12173-CF
ADCK4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12173-NF
ADCK4 cDNA ORF Clone, Human, N-His tag HG12173-NH
ADCK4 cDNA ORF Clone, Human, C-HA tag HG12173-CY
ADCK4 cDNA ORF Clone, Human, N-HA tag HG12173-NY
ADCK4 cDNA ORF Clone, Human, C-Myc tag HG12173-CM
ADCK4 cDNA ORF Clone, Human, N-Myc tag HG12173-NM
ADCK4 qPCR Primer Pairs, Human HP101833
info info
添加购物车成功! 添加购物车失败!