ADAMTSL1 cDNA ORF Clone, Human, C-HA tag

Cat: HG13550-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ADAMTSL1 Reagents
CRO Services
Product recommended

All ADAMTSL1 Reagents
ADAMTSL1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1320 bp
Description
Full length Clone DNA of Human ADAMTS-like 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADAMTSL1 cDNA ORF Clone, Human, C-HA tag Alternative Names
ADAMTSL-1 cDNA ORF Clone, Human;ADAMTSR1 cDNA ORF Clone, Human;C9orf94 cDNA ORF Clone, Human;PUNCTIN cDNA ORF Clone, Human
ADAMTSL1 Background Information

ADAMTSL1 is a secreted molecule resembling members of the ADAMTS protein family of matrix metalloproteinases. Both ADAMTS proteins and ADAM protein family contain a disintegrin and a metalloprotease domain. Metallospondins is collective term for members of ADAMTS protein family. ADAMTS proteins lack the EGF-like domain found normally in members of the ADAM protein family. They also do not possess the canonical disintegrin sequence found in the ADAM protein family. It contains the domains found in members of the ADAMTS protein family with the exception of the pro-metalloprotease and the disintegrin-like domain typical of this family. ADAMTSL1 gene is expressed in adult skeletal muscle. ADAMTSL1 may play an important role in the extracellular matrix as it is deposited in the cell substratum in a punctate fashion and is excluded from focal contacts.

Full Name
ADAMTS-like 1
References
  • Hirohata S, et al. (2002) Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in extracellular matrix. J Biol Chem. 277 (14): 12182-9.
  • Wang LW, et al. (2007) O-fucosylation of thrombospondin type 1 repeats in ADAMTS-like-1/punctin-1 regulates secretion: implications for the ADAMTS superfamily. J Biol Chem. 282 (23): 17024-31.
  • Hall NG, et al. (2004) ADAMTSL-3/punctin-2, a novel glycoprotein in extracellular matrix related to the ADAMTS family of metalloproteases. Matrix Biol. 22 (6): 501-10.
  • info info
    添加购物车成功! 添加购物车失败!