ADAMTS4 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ADAMTS4 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2514 bp
Description
Full length Clone DNA of Human ADAM metallopeptidase with thrombospondin type 1 motif, 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ADAMTS4 cDNA ORF Clone, Human, N-His tag: Alternative Names

ADAMTS-2 cDNA ORF Clone, Human; ADAMTS-4 cDNA ORF Clone, Human; ADMP-1 cDNA ORF Clone, Human

ADAMTS4 Background Information

ADAMTSs (A disintegrin and metalloprotease domains with thrombospondins motifs) are a family of extracellular proteases that have been related to both oncogenic and tumor-suppressive functions. The ADAMTS4 (a disintegrin and metalloproteinase with thrombospondin motifs 4) enzyme is a matrix-associated zinc metalloendopeptidase that plays an essential role in the degradation of cartilage aggrecan in arthritic diseases and has been recognized as one of the most primary targets for therapeutic intervention in osteoarthritis (OA). ADAMTS4 knockdown had no inhibitory implications on cell proliferation and invasion in vitro, but significantly attenuated tumor growth in vivo. Mechanistically, we revealed that ADAMTS4 was associated macrophages infiltration and polarization in the tumor microenvironment of CRC. Macrophage depletion largely abolished the promotive effect of ADAMTS4 on tumor growth in the immune competent BALB/c mice. CONCLUSION: ADAMTS4 seemed to be a promising prognostic indicator in CRC. The novel link between ADAMTS4 and macrophages mirrors the potential regulatory roles of ADAMTSs in the inflammatory microenvironment of cancers. Host-derived ADAMTS4 was expressed at the tumor vessels and was associated with early-stage tumor growth. ADAMTS4 (a disintegrin and metalloproteinase with thrombospondin motifs 4) is a pathogenic factor of plaque vulnerability in mice. ADAMTS4 may be a potential biomarker for plaque vulnerability.
Full Name
ADAM metallopeptidase with thrombospondin type 1 motif, 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait