ADAMTS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10493-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADAMTS1 Reagents
CRO Services
Product recommended

All ADAMTS1 Reagents
ADAMTS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2904 bp
Description
Full length Clone DNA of Human ADAM metallopeptidase with thrombospondin type 1 motif, 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADAMTS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C3-C5 cDNA ORF Clone, Human;METH1 cDNA ORF Clone, Human
ADAMTS1 Background Information
Full Name
ADAM metallopeptidase with thrombospondin type 1 motif, 1

ADAMTS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADAMTS1 cDNA ORF Clone in Cloning Vector, Mouse MG51141-G
ADAMTS1 cDNA ORF Clone, Mouse, untagged MG51141-UT
ADAMTS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51141-ACG
ADAMTS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51141-ACGLN
ADAMTS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51141-ACR
ADAMTS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51141-CF
ADAMTS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51141-NF
ADAMTS1 cDNA ORF Clone, Mouse, C-His tag MG51141-CH
ADAMTS1 cDNA ORF Clone, Mouse, N-His tag MG51141-NH
ADAMTS1 cDNA ORF Clone, Mouse, C-HA tag MG51141-CY
ADAMTS1 cDNA ORF Clone, Mouse, N-HA tag MG51141-NY
ADAMTS1 cDNA ORF Clone, Mouse, C-Myc tag MG51141-CM
ADAMTS1 cDNA ORF Clone, Mouse, N-Myc tag MG51141-NM

ADAMTS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADAMTS1 cDNA ORF Clone in Cloning Vector, Human HG10493-M
ADAMTS1 cDNA ORF Clone, Human, untagged HG10493-UT
ADAMTS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10493-ACG
ADAMTS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10493-ACGLN
ADAMTS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10493-ACR
ADAMTS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10493-NF
ADAMTS1 cDNA ORF Clone, Human, C-His tag HG10493-CH
ADAMTS1 cDNA ORF Clone, Human, N-His tag HG10493-NH
ADAMTS1 cDNA ORF Clone, Human, C-HA tag HG10493-CY
ADAMTS1 cDNA ORF Clone, Human, N-HA tag HG10493-NY
ADAMTS1 cDNA ORF Clone, Human, C-Myc tag HG10493-CM
ADAMTS1 cDNA ORF Clone, Human, N-Myc tag HG10493-NM
ADAMTS1 qPCR Primer Pairs, Human HP100514
info info
添加购物车成功! 添加购物车失败!