After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ADAM12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ADAM12 cDNA Clone Product Information
NCBI RefSeq:NM_003474.4
RefSeq ORF Size:2721bp
cDNA Description:Full length Clone DNA of Homo sapiens ADAM metallopeptidase domain 12, transcript variant 1 with N terminal His tag.
Gene Synonym:RP11-295J3.5, MCMP, MCMPMltna, MLTN, MLTNA
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The ADAMs (a disintegrin and metalloprotease) comprise a family of multidomain proteins with metalloprotease, cell adhesion, and signaling activities. Human ADAM12, which is implicated in diseases such as cancer, is expressed in two splice forms, the transmembrane ADAM12-L and the shorter and soluble ADAM12-S. ADAM12, also known as and Meltrin alpha, is a member of the ADAM protein family, which contains one disintegrin domain, one EGF-like domain and one peptidase M12B domain. ADAM12 is synthesized as a zymogen with the prodomain keeping the metalloprotease inactive through a cysteine-switch mechanism. Maturation and activation of the protease involves the cleavage of the prodomain in the trans-Golgi or possibly at the cell surface by a furin-peptidase. It is a membrane-anchored metalloprotease, which has been implicated in activation-inactivation of growth factors that play an important role in wound healing, including heparin-binding epidermal growth factor (EGF)-like growth factor (HB-EGF) and IGF binding proteins. ADAM12 may also regulate cell-cell and cell-extracellular matrix contacts through interactions with cell surface receptors - integrins and syndecans - potentially influencing the actin cytoskeleton. Moreover, ADAM12 interacts with several cytoplasmic signaling and adaptor molecules through its intracellular domain, thereby directly transmitting signals to or from the cell interior. These ADAM12-mediated cellular effects appear to be critical events in both biological and pathological processes. In addition to protease activity, ADAM12 possesses cell binding and cell signaling properties. In many studies, ADAM12 overexpression has been correlated with disease, and ADAM12 has been shown to promote tumor growth and progression in cancer. On the other hand, protective effects of ADAM12 in disease have also been reported.

References
  • Wewer UM, et al. (2006) ADAM12 is a four-leafed clover: the excised prodomain remains bound to the mature enzyme. J Biol Chem. 281(14): 9418-22.
  • Kveiborg M, et al. (2008) Cellular roles of ADAM12 in health and disease. Int J Biochem Cell Biol. 40(9): 1685-702.
  • Harsha A, et al. (2008) ADAM12: a potential target for the treatment of chronic wounds. J Mol Med. 86(8): 961-9.
  • Jacobsen J, et al. (2009) Targeting ADAM12 in human disease: head, body or tail? Curr Pharm Des. 15(20): 2300-10.
  • Baertling F, et al. (2010) ADAM12 is expressed by astrocytes during experimental demyelination. Brain Res. 1326: 1-14.
  • Size / Price
    Catalog: HG10896-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"