ACVR2B cDNA ORF Clone, Human, N-His tag

Cat: HG10229-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ACVR2B Reagents
CRO Services
Product recommended

All ACVR2B Reagents
ACVR2B cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1539 bp
Description
Full length Clone DNA of Human activin A receptor, type I IB with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACVR2B cDNA ORF Clone, Human, N-His tag Alternative Names
Activin RIIB cDNA ORF Clone, Human;ActR-IIB cDNA ORF Clone, Human;ACTRIIB cDNA ORF Clone, Human;HTX4 cDNA ORF Clone, Human
ACVR2B Background Information

ACVR2A and ACVR2B are two activin type II receptors. ACVR2B is integral to the activin and myostatin signaling pathway. Ligands such as activin and myostatin bind to ACVR2A and ACVR2B. Myostatin, a negative regulator of skeletal muscle growth, is regarded as a potential therapeutic target and binds to ACVR2B effectively, and to a lesser extent, to ACVR2A. The structure of human ACVR2B kinase domain in complex with adenine establishes the conserved bilobal architecture consistent with all other catalytic kinase domains. Haplotype structure at the ACVR2B and follistatin loci may contribute to interindividual variation in skeletal muscle mass and strength. Defects in ACVR2B are a cause of left-right axis malformations.

Full Name
activin A receptor, type IIB
References
  • Kosaki R, et al. (1999) Left-right axis malformations associated with mutations in ACVR2B, the gene for human activin receptor type IIB. Am J Med Genet. 82(1):70-6.
  • Dupont S, et al. (2001) No evidence for linkage or for diabetes-associated mutations in the activin type 2B receptor gene (ACVR2B) in French patients with mature-onset diabetes of the young or type 2 diabetes. Diabetes 50(5):1219-21.
  • Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  • Walsh S, et al. (2007) Activin-type II receptor B (ACVR2B) and follistatin haplotype associations with muscle mass and strength in humans. J Appl Physiol. 102(6):2142-8.
  • ACVR2B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ACVR2B cDNA ORF Clone in Cloning Vector, Mouse MG50173-M
    ACVR2B cDNA ORF Clone, Mouse, untagged MG50173-UT
    ACVR2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50173-ACG
    ACVR2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50173-ACGLN
    ACVR2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50173-ACR
    ACVR2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50173-CF
    ACVR2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50173-NF
    ACVR2B cDNA ORF Clone, Mouse, C-His tag MG50173-CH
    ACVR2B cDNA ORF Clone, Mouse, N-His tag MG50173-NH
    ACVR2B cDNA ORF Clone, Mouse, C-HA tag MG50173-CY
    ACVR2B cDNA ORF Clone, Mouse, N-HA tag MG50173-NY
    ACVR2B cDNA ORF Clone, Mouse, C-Myc tag MG50173-CM
    ACVR2B cDNA ORF Clone, Mouse, N-Myc tag MG50173-NM
    ACVR2B qPCR Primer Pairs, Mouse MP200203

    ACVR2B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ACVR2B cDNA ORF Clone in Cloning Vector, Human HG10229-M
    ACVR2B cDNA ORF Clone, Human, untagged HG10229-UT
    ACVR2B cDNA ORF Clone, Human, C-GFPSpark® tag HG10229-ACG
    ACVR2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10229-ACGLN
    ACVR2B cDNA ORF Clone, Human, C-OFPSpark® tag HG10229-ACR
    ACVR2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10229-CF
    ACVR2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10229-NF
    ACVR2B cDNA ORF Clone, Human, C-His tag HG10229-CH
    ACVR2B cDNA ORF Clone, Human, C-HA tag HG10229-CY
    ACVR2B cDNA ORF Clone, Human, N-HA tag HG10229-NY
    ACVR2B cDNA ORF Clone, Human, C-Myc tag HG10229-CM
    ACVR2B cDNA ORF Clone, Human, N-Myc tag HG10229-NM
    ACVR2B qPCR Primer Pairs, Human HP100284
    info info
    添加购物车成功! 添加购物车失败!