Quick Order

Human ACVR2A Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ACVR2A cDNA Clone Product Information
NCBI RefSeq:NM_001616.3
RefSeq ORF Size:1542bp
cDNA Description:Full length Clone DNA of Homo sapiens activin A receptor, type I IA with N terminal His tag.
Gene Synonym:ACVR2A, ACVR2, ACTRII
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ACVR2A and ACVR2B are two activin type II receptors. ACVR2A has been shown to interact with INHBA, SYNJ2BP and ACVR1B. The bovine ACVR2A gene encodes a protein of 513 amino acids which is highly homologous (approximately 98% identity) to the rat, mouse, and human ACVR2A proteins. Inactivation of ACVR2A is a common event in prostate cancer cells suggesting it may play an important role in the development of prostate cancer. The ACVR2A gene is a putative tumor suppressor gene that is frequently mutated in microsatellite-unstable colon cancers (MSI-H colon cancers). Frameshift mutation of ACVR2A may contribute to MSI-H colon tumorigenesis via disruption of alternate TGF-beta effector pathways.

References
  • Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  • Chung H, et al. (2008) Mutation rates of TGFBR2 and ACVR2 coding microsatellites in human cells with defective DNA mismatch repair. PloS one 3(10): e3463.
  • Fitzpatrick E, et al. (2009) Genetic association of the activin A receptor gene (ACVR2A) and pre-eclampsia. Molecular human reproduction 15(3):195-204.
  • Roten LT, et al. (2009) Association between the candidate susceptibility gene ACVR2A on chromosome 2q22 and pre-eclampsia in a large Norwegian population-based study (the HUNT study). EJHG. 17(2): 250-7.
  • Size / Price
    Catalog: HG10257-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"