ACVR1 cDNA ORF Clone, Human, N-His tag

Cat: HG14875-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACVR1 Reagents
CRO Services
Product recommended

All ACVR1 Reagents
ACVR1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1530 bp
Description
Full length Clone DNA of Human activin A receptor, type I with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACVR1 cDNA ORF Clone, Human, N-His tag Alternative Names
ACTRI cDNA ORF Clone, Human;ACVR1A cDNA ORF Clone, Human;ACVRLK2 cDNA ORF Clone, Human;ALK2 cDNA ORF Clone, Human;FOP cDNA ORF Clone, Human;SKR1 cDNA ORF Clone, Human;TSRI cDNA ORF Clone, Human
ACVR1 Background Information

ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability to bind activin in concert with ActRII or ActRIIB. ALK-2 is also identified as a BMP type I receptor. It has been demonstrated that ALK-2 forms complex with either the BMP-2/7-bound BMPR-II or ACVR2A /ACVR2B. ALK-1 and ALK-2 presenting in the yeast Saccharomyces cerevisiae are two haspin homologues. Both ALK-1 and ALK-2 exhibit a weak auto-kinase activity in vitro, and are phosphoproteins in vivo. ALK-1 and ALK-2 levels peak in mitosis and late-S/G2. Control of protein stability plays a major role in ALK-2 regulation. The half-life of ALK-2 is particularly short in G1. Overexpression of ALK-2, but not of ALK-1, causes a mitotic arrest, which is correlated to the kinase activity of the protein. This suggests a role for ALK-2 in the control of mitosis. Endoglin is phosphorylated on cytosolic domain threonine residues by the TGF-beta type I receptors ALK-2 and ALK-5 in prostate cancer cells. Endoglin did not inhibit cell migration in the presence of constitutively active ALK-2. Defects in ALK-2 are a cause of fibrodysplasia ossificans progressiva (FOP).

Full Name
activin A receptor, type I
References
  • Armes NA,et al. (1997) The ALK-2 and ALK-4 activin receptors transduce distinct mesoderm-inducing signals during early Xenopus development but do not co-operate to establish thresholds. Development 124(19): 3797-804.
  • Armes NA, et al. (1999) A short loop on the ALK-2 and ALK-4 activin receptors regulates signaling specificity but cannot account for all their effects on early Xenopus development. J Biol Chem. 274(12):7929-35.
  • Kawai S, et al. (2000) Mouse smad8 phosphorylation downstream of BMP receptors ALK-2, ALK-3, and ALK-6 induces its association with Smad4 and transcriptional activity.Biochem Biophys Res Commun. 271(3):682-7.
  • Deng Y, et al. (2009) Efficient highly selective synthesis of methyl 2-(ethynyl)alk-2(E)-enoates and 2-(1'-chlorovinyl)alk-2(Z)-enoates from 2-(methoxycarbonyl)-2,3-allenols. Organic letters 11(10):2169-72.
  • ACVR1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    ACVR1 cDNA ORF Clone in Cloning Vector, Rhesus CG90058-G
    ACVR1 cDNA ORF Clone, Rhesus, untagged CG90058-UT
    ACVR1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90058-ACG
    ACVR1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90058-ACGLN
    ACVR1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90058-ACR
    ACVR1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90058-CF
    ACVR1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90058-NF
    ACVR1 cDNA ORF Clone, Rhesus, C-His tag CG90058-CH
    ACVR1 cDNA ORF Clone, Rhesus, N-His tag CG90058-NH
    ACVR1 cDNA ORF Clone, Rhesus, C-HA tag CG90058-CY
    ACVR1 cDNA ORF Clone, Rhesus, N-HA tag CG90058-NY
    ACVR1 cDNA ORF Clone, Rhesus, C-Myc tag CG90058-CM
    ACVR1 cDNA ORF Clone, Rhesus, N-Myc tag CG90058-NM

    ACVR1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    ACVR1 cDNA ORF Clone in Cloning Vector, Canine DG70048-G
    ACVR1 cDNA ORF Clone, Canine, untagged DG70048-UT
    ACVR1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70048-ACGLN
    ACVR1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70048-ACG
    ACVR1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70048-ACR
    ACVR1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70048-CF
    ACVR1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70048-NF
    ACVR1 cDNA ORF Clone, Canine, C-His tag DG70048-CH
    ACVR1 cDNA ORF Clone, Canine, N-His tag DG70048-NH
    ACVR1 cDNA ORF Clone, Canine, C-HA tag DG70048-CY
    ACVR1 cDNA ORF Clone, Canine, N-HA tag DG70048-NY
    ACVR1 cDNA ORF Clone, Canine, C-Myc tag DG70048-CM
    ACVR1 cDNA ORF Clone, Canine, N-Myc tag DG70048-NM

    ACVR1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ACVR1 cDNA ORF Clone in Cloning Vector, Rat RG80118-G
    ACVR1 cDNA ORF Clone, Rat, untagged RG80118-UT
    ACVR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80118-ACGLN
    ACVR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80118-ACG
    ACVR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80118-ACR
    ACVR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80118-CF
    ACVR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80118-NF
    ACVR1 cDNA ORF Clone, Rat, C-His tag RG80118-CH
    ACVR1 cDNA ORF Clone, Rat, N-His tag RG80118-NH
    ACVR1 cDNA ORF Clone, Rat, C-HA tag RG80118-CY
    ACVR1 cDNA ORF Clone, Rat, N-HA tag RG80118-NY
    ACVR1 cDNA ORF Clone, Rat, C-Myc tag RG80118-CM
    ACVR1 cDNA ORF Clone, Rat, N-Myc tag RG80118-NM
    ACVR1 qPCR Primer Pairs, Rat RP300113

    ACVR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ACVR1 cDNA ORF Clone in Cloning Vector, Mouse MG50297-M
    ACVR1 cDNA ORF Clone, Mouse, untagged MG50297-UT
    ACVR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50297-ACGLN
    ACVR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50297-ACG
    ACVR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50297-ACR
    ACVR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50297-CF
    ACVR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50297-NF
    ACVR1 cDNA ORF Clone, Mouse, C-His tag MG50297-CH
    ACVR1 cDNA ORF Clone, Mouse, N-His tag MG50297-NH
    ACVR1 cDNA ORF Clone, Mouse, C-HA tag MG50297-CY
    ACVR1 cDNA ORF Clone, Mouse, N-HA tag MG50297-NY
    ACVR1 cDNA ORF Clone, Mouse, C-Myc tag MG50297-CM
    ACVR1 cDNA ORF Clone, Mouse, N-Myc tag MG50297-NM
    ACVR1 qPCR Primer Pairs, Mouse MP200320

    ACVR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ACVR1 cDNA ORF Clone in Cloning Vector, Human HG14875-G
    ACVR1 cDNA ORF Clone in Cloning Vector, Human HG10227-M
    ACVR1 cDNA ORF Clone, Human, untagged HG14875-UT
    ACVR1 cDNA ORF Clone, Human, untagged HG10227-UT
    ACVR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14875-ACG
    ACVR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14875-ACGLN
    ACVR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10227-ACGLN
    ACVR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10227-ACG
    ACVR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10227-ACR
    ACVR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14875-ACR
    ACVR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14875-CF
    ACVR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10227-CF
    ACVR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14875-NF
    ACVR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10227-NF
    ACVR1 cDNA ORF Clone, Human, C-His tag HG14875-CH
    ACVR1 cDNA ORF Clone, Human, C-His tag HG10227-CH
    ACVR1 cDNA ORF Clone, Human, N-His tag HG10227-NH
    ACVR1 cDNA ORF Clone, Human, C-HA tag HG14875-CY
    ACVR1 cDNA ORF Clone, Human, C-HA tag HG10227-CY
    ACVR1 cDNA ORF Clone, Human, N-HA tag HG14875-NY
    ACVR1 cDNA ORF Clone, Human, N-HA tag HG10227-NY
    ACVR1 cDNA ORF Clone, Human, C-Myc tag HG10227-CM
    ACVR1 cDNA ORF Clone, Human, C-Myc tag HG14875-CM
    ACVR1 cDNA ORF Clone, Human, N-Myc tag HG14875-NM
    ACVR1 cDNA ORF Clone, Human, N-Myc tag HG10227-NM
    ACVR1 qPCR Primer Pairs, Human HP100282
    info info
    添加购物车成功! 添加购物车失败!