CTRN2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14110-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CTRN2 Reagents
CRO Services
Product recommended

All CTRN2 Reagents
CTRN2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1131 bp
Description
Full length Clone DNA of Human ARP1 actin-related protein 1 homolog B, centractin beta (yeast) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CTRN2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ARP1B cDNA ORF Clone, Human;CTRN2 cDNA ORF Clone, Human;PC3 cDNA ORF Clone, Human
CTRN2 Background Information
Full Name
ARP1 actin-related protein 1 homolog B, centractin beta (yeast)

CTRN2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CTRN2 cDNA ORF Clone in Cloning Vector, Mouse MG52703-G
CTRN2 cDNA ORF Clone, Mouse, untagged MG52703-UT
CTRN2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52703-ACG
CTRN2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52703-ACGLN
CTRN2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52703-ANG
CTRN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52703-ACR
CTRN2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52703-ANR
CTRN2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52703-CF
CTRN2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52703-NF
CTRN2 cDNA ORF Clone, Mouse, C-His tag MG52703-CH
CTRN2 cDNA ORF Clone, Mouse, N-His tag MG52703-NH
CTRN2 cDNA ORF Clone, Mouse, C-HA tag MG52703-CY
CTRN2 cDNA ORF Clone, Mouse, N-HA tag MG52703-NY
CTRN2 cDNA ORF Clone, Mouse, C-Myc tag MG52703-CM
CTRN2 cDNA ORF Clone, Mouse, N-Myc tag MG52703-NM
CTRN2 qPCR Primer Pairs, Mouse MP202574

CTRN2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CTRN2 cDNA ORF Clone in Cloning Vector, Human HG14110-G
CTRN2 cDNA ORF Clone, Human, untagged HG14110-UT
CTRN2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14110-ACGLN
CTRN2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14110-ACG
CTRN2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14110-ANG
CTRN2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14110-ACR
CTRN2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14110-ANR
CTRN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14110-CF
CTRN2 cDNA ORF Clone, Human, C-His tag HG14110-CH
CTRN2 cDNA ORF Clone, Human, N-His tag HG14110-NH
CTRN2 cDNA ORF Clone, Human, C-HA tag HG14110-CY
CTRN2 cDNA ORF Clone, Human, N-HA tag HG14110-NY
CTRN2 cDNA ORF Clone, Human, C-Myc tag HG14110-CM
CTRN2 cDNA ORF Clone, Human, N-Myc tag HG14110-NM
CTRN2 qPCR Primer Pairs, Human HP102763
info info
添加购物车成功! 添加购物车失败!