Text Size:AAA

Human alpha Actinin 4/ACTN4 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human ACTN4 cDNA Clone Product Information
    NCBI RefSeq:NM_004924.3
    RefSeq ORF Size:2736bp
    cDNA Description:Full length Clone DNA of Homo sapiens actinin, alpha 4 with C terminal HA tag.
    Gene Synonym:FSGS, FSGS1, ACTININ-4, DKFZp686K23158
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACTN4 qPCR primers for gene expression analysis, HP100845 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Actinin, alpha 4 (ACTN4), a nonmuscle cytoskeleton protein, has been frequently reported to be associated with cell motility and cancer metastasis. Honda et al. have suggested that cytoplasmic ACTN4 increases cell motility and is associated with a high metastatic potential and a poor prognosis of cancer based on their studies on multiple cancer cell lines. Since then, ACTN4 has been reported to be associated with the progression and metastasis of many types of cancer, including breast, colorectal, pancreatic, lung, brain, bladder, and ovarian cancers and salivary gland carcinoma.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Gao Y, Li G, Sun L, et al. ACTN4 and the pathways associated with cell motility and adhesion contribute to the process of lung cancer metastasis to the brain. BMC Cancer. 2015;15:277.
  • Fukumoto M, Kurisu S, Yamada T, Takenawa T. α-Actinin-4 Enhances Colorectal Cancer Cell Invasion by Suppressing Focal Adhesion Maturation. St-Pierre Y, ed. PLoS ONE. 2015;10(4):e0120616.
  • Size / Price
    Catalog: HG10971-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"