alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, C-His tag

Cat: HG12130-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All alpha-actinin-3/ACTN3 Reagents
CRO Services
Product recommended

All alpha-actinin-3/ACTN3 Reagents
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2706 bp
Description
Full length Clone DNA of Human actinin, alpha 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha-actinin-3/ACTN3 Background Information
Full Name
actinin alpha 3 (gene/pseudogene)

alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
alpha-actinin-3/ACTN3 cDNA ORF Clone in Cloning Vector, Mouse MG58956-U
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, untagged MG58956-UT
alpha-actinin-3/ACTN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58956-ACGLN
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58956-ACG
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58956-ANG
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58956-ACR
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58956-ANR
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58956-CF
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58956-NF
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, C-His tag MG58956-CH
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, N-His tag MG58956-NH
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, C-HA tag MG58956-CY
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, N-HA tag MG58956-NY
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, C-Myc tag MG58956-CM
alpha-actinin-3/ACTN3 cDNA ORF Clone, Mouse, N-Myc tag MG58956-NM

alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
alpha-actinin-3/ACTN3 cDNA ORF Clone in Cloning Vector, Human HG12130-M
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, untagged HG12130-UT
alpha-actinin-3/ACTN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12130-ACGLN
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG12130-ACG
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, N-GFPSpark® tag HG12130-ANG
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG12130-ACR
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, N-OFPSpark® tag HG12130-ANR
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12130-CF
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12130-NF
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, N-His tag HG12130-NH
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, C-HA tag HG12130-CY
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, N-HA tag HG12130-NY
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, C-Myc tag HG12130-CM
alpha-actinin-3/ACTN3 cDNA ORF Clone, Human, N-Myc tag HG12130-NM
alpha-actinin-3/ACTN3 qPCR Primer Pairs, Human HP101656
info info
添加购物车成功! 添加购物车失败!