alpha smooth muscle Actin cDNA ORF Clone, Human, C-His tag

Cat: HG12160-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All alpha smooth muscle Actin Reagents
CRO Services
Product recommended

All alpha smooth muscle Actin Reagents
alpha smooth muscle Actin cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Human actin, alpha 2, smooth muscle, aorta with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha smooth muscle Actin cDNA ORF Clone, Human, C-His tag Alternative Names
AAT6 cDNA ORF Clone, Human;ACTSA cDNA ORF Clone, Human;MYMY5 cDNA ORF Clone, Human
alpha smooth muscle Actin Background Information

Actins are globular multi-functional proteins which can be detected in all eukaryotic cells. In vertebrates, there are three main groups of actins that possess slightly different functions: alpha, beta, and gamma. The alpha actins, found in muscle tissues, are a major constituent of the contractile apparatus. Beta-actin, found at the expanding edge of cells, uses the projection of its cellular structure as its mean of mobility. Gamma-actin is found in the filaments of stress fibres. ACTA2 is an alpha actin that is found in skeletal muscle. Expression of alpha skeletal, alpha cardiac, alpha vascular, and gamma enteric actins are restricted to specialized muscle cell type. Smooth muscle alpha actin is of further interest because it is one of a few genes whose expression is relatively restricted to vascular smooth muscle cells. Further more, expression of smooth muscle alpha actin is regulated by hormones, cell proliferation, and altered by pathological conditions including oncogenic transformation and atherosclerosis.

Full Name
actin, alpha 2, smooth muscle, aorta
References
  • Ueyama H, et al., 1990, Jinrui Idengaku Zasshi. 35(2): 145-50.
  • Snásel J, et al., 1997, Folia Biol. 42(5): 227-30.
  • Adams LD, et al., 1992, AIDS Res Hum. 8(2): 291-5.
  • alpha smooth muscle Actin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    alpha smooth muscle Actin cDNA ORF Clone in Cloning Vector, Mouse MG53668-U
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, untagged MG53668-UT
    alpha smooth muscle Actin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53668-ACGLN
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53668-ACG
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53668-ANG
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53668-ACR
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53668-ANR
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53668-CF
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53668-NF
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, C-His tag MG53668-CH
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, N-His tag MG53668-NH
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, C-HA tag MG53668-CY
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, N-HA tag MG53668-NY
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, C-Myc tag MG53668-CM
    alpha smooth muscle Actin cDNA ORF Clone, Mouse, N-Myc tag MG53668-NM

    alpha smooth muscle Actin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    alpha smooth muscle Actin cDNA ORF Clone in Cloning Vector, Human HG12160-G
    alpha smooth muscle Actin cDNA ORF Clone, Human, untagged HG12160-UT
    alpha smooth muscle Actin cDNA ORF Clone, Human, C-GFPSpark® tag HG12160-ACG
    alpha smooth muscle Actin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12160-ACGLN
    alpha smooth muscle Actin cDNA ORF Clone, Human, N-GFPSpark® tag HG12160-ANG
    alpha smooth muscle Actin cDNA ORF Clone, Human, C-OFPSpark® tag HG12160-ACR
    alpha smooth muscle Actin cDNA ORF Clone, Human, N-OFPSpark® tag HG12160-ANR
    alpha smooth muscle Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12160-CF
    alpha smooth muscle Actin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12160-NF
    alpha smooth muscle Actin cDNA ORF Clone, Human, N-His tag HG12160-NH
    alpha smooth muscle Actin cDNA ORF Clone, Human, C-HA tag HG12160-CY
    alpha smooth muscle Actin cDNA ORF Clone, Human, N-HA tag HG12160-NY
    alpha smooth muscle Actin cDNA ORF Clone, Human, C-Myc tag HG12160-CM
    alpha smooth muscle Actin cDNA ORF Clone, Human, N-Myc tag HG12160-NM
    alpha smooth muscle Actin qPCR Primer Pairs, Human HP101794
    info info
    添加购物车成功! 添加购物车失败!