Quick Order

Human ACTA2 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human ACTA2 cDNA Clone Product Information
    NCBI RefSeq:BC017554
    RefSeq ORF Size:1134bp
    cDNA Description:Full length Clone DNA of Homo sapiens actin, alpha 2, smooth muscle, aorta with C terminal His tag.
    Gene Synonym:AAT6, ACTSA, MYMY5, ACTA2
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACTA2 qPCR primers for gene expression analysis, HP101794 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Actins are globular multi-functional proteins which can be detected in all eukaryotic cells. In vertebrates, there are three main groups of actins that possess slightly different functions: alpha, beta, and gamma. The alpha actins, found in muscle tissues, are a major constituent of the contractile apparatus. Beta-actin, found at the expanding edge of cells, uses the projection of its cellular structure as its mean of mobility. Gamma-actin is found in the filaments of stress fibres. ACTA2 is an alpha actin that is found in skeletal muscle. Expression of alpha skeletal, alpha cardiac, alpha vascular, and gamma enteric actins are restricted to specialized muscle cell type. Smooth muscle alpha actin is of further interest because it is one of a few genes whose expression is relatively restricted to vascular smooth muscle cells. Further more, expression of smooth muscle alpha actin is regulated by hormones, cell proliferation, and altered by pathological conditions including oncogenic transformation and atherosclerosis.

    References
  • Ueyama H, et al., 1990, Jinrui Idengaku Zasshi. 35(2): 145-50.
  • Snásel J, et al., 1997, Folia Biol. 42(5): 227-30.
  • Adams LD, et al., 1992, AIDS Res Hum. 8(2): 291-5.
  • Size / Price
    Catalog: HG12160-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"