After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ACPL2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ACPL2 cDNA Clone Product Information
NCBI RefSeq:NM_152282.3
RefSeq ORF Size:1443bp
cDNA Description:Full length Clone DNA of Homo sapiens acid phosphatase-like 2.
Gene Synonym:FLJ23751, ACPL2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to the histidine acid phosphatase family. A large-scale effort, termed the Secreted Protein Discovery Initiative (SPDI), was undertaken to identify novel secreted and transmembrane proteins. In the first of several approaches, a biological signal sequence trap in yeast cells was utilized to identify cDNA clones encoding putative secreted proteins. A second strategy utilized various algorithms that recognize features such as the hydrophobic properties of signal sequences to identify putative proteins encoded by expressed sequence tags (ESTs) from human cDNA libraries. A third approach surveyed ESTs for protein sequence similarity to a set of known receptors and their ligands with the BLAST algorithm. Finally, both signal-sequence prediction algorithms and BLAST were used to identify single exons of potential genes from within human genomic sequence.

References
  • Clark HF., et al., 2003, Genome Res. 13: 2265-70.
  • Ota T.et al., 2004, Nat. Genet. 36:40-5.
  • Size / Price
    Catalog: HG11243-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"