ACOX1 cDNA ORF Clone, Human, untagged

Cat: HG11266-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACOX1 Reagents
CRO Services
Product recommended

All ACOX1 Reagents
ACOX1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1983 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human acyl-Coenzyme A oxidase 1, palmitoyl.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 1.98kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ACOX1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACOX1 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
ACOX1 cDNA ORF Clone, Human, untagged Alternative Names
ACOX cDNA ORF Clone, Human;PALMCOX cDNA ORF Clone, Human;SCOX cDNA ORF Clone, Human
ACOX1 Background Information

Peroxisomal acyl-coenzyme A oxidase 1(ACOX1 or AOX) is the first enzyme of the fatty acid beta-oxidation pathway and belongs to the Acyl-CoA oxidase family. Human liver peroxisomes contain two acyl-CoA oxidases, namely, palmitoyl-CoA oxidase (ACOX1/AOX) and a branched chain acyl-CoA oxidase. The palmitoyl-CoA oxidase (ACOX1/AOX) oxidizes the CoA esters of straight chain fatty acids and prostaglandins and donates electrons directly to molecular oxygen, thereby producing H2O2. Human ACOX1/AOX is a protein of 661-amino acids, including the carboxyl-terminal sequence(Ser-Lys-Leu) known as a minimal peroxisome-targeting signal. Human ACOX1/AOX, the first and rate-limiting enzyme of the peroxisomal β-oxidation pathway, has two isoforms including ACOX1a and ACOX1b, transcribed from a single gene. The human ACOX1b isoform is more effective than the ACOX1a isoform in reversing the Acox1 null phenotype in the mouse partly because of the Substrate utilization differences.

Full Name
acyl-CoA oxidase 1, palmitoyl
References
  • Vluggens A, et al. (2010) Functional significance of the two ACOX1 isoforms and their crosstalks with PPAR alpha and RXR alpha. Laboratory Investigation. 90: 696-708.
  • Chu R, et al. (1995) Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells. J Biol Chem. 270 (9): 4908-15.
  • Aoyama T, et al. (1994) Molecular cloning and functional expression of a human peroxisomal acyl-coenzyme A oxidase. Biochem Biophys Res Commun. 198 (3): 1113-8.
  • info info
    添加购物车成功! 添加购物车失败!