THEM2 cDNA ORF Clone, Human, untagged

Cat: HG15437-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All THEM2 Reagents
CRO Services
Product recommended

All THEM2 Reagents
THEM2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Human acyl-CoA thioesterase 13.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

THEM2 cDNA ORF Clone, Human, untagged Alternative Names
ACOT13 cDNA ORF Clone, Human;HT012 cDNA ORF Clone, Human;PNAS-27 cDNA ORF Clone, Human;THEM2 cDNA ORF Clone, Human
THEM2 Background Information
Full Name
acyl-CoA thioesterase 13

THEM2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
THEM2 cDNA ORF Clone in Cloning Vector, Mouse MG53264-U
THEM2 cDNA ORF Clone, Mouse, untagged MG53264-UT
THEM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53264-ACGLN
THEM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53264-ACG
THEM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53264-ANG
THEM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53264-ACR
THEM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53264-ANR
THEM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53264-CF
THEM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53264-NF
THEM2 cDNA ORF Clone, Mouse, C-His tag MG53264-CH
THEM2 cDNA ORF Clone, Mouse, N-His tag MG53264-NH
THEM2 cDNA ORF Clone, Mouse, C-HA tag MG53264-CY
THEM2 cDNA ORF Clone, Mouse, N-HA tag MG53264-NY
THEM2 cDNA ORF Clone, Mouse, C-Myc tag MG53264-CM
THEM2 cDNA ORF Clone, Mouse, N-Myc tag MG53264-NM

THEM2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
THEM2 cDNA ORF Clone in Cloning Vector, Human HG15437-G
THEM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15437-ACG
THEM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15437-ACGLN
THEM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15437-ANG
THEM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15437-ACR
THEM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15437-ANR
THEM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15437-CF
THEM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15437-NF
THEM2 cDNA ORF Clone, Human, C-His tag HG15437-CH
THEM2 cDNA ORF Clone, Human, N-His tag HG15437-NH
THEM2 cDNA ORF Clone, Human, C-HA tag HG15437-CY
THEM2 cDNA ORF Clone, Human, N-HA tag HG15437-NY
THEM2 cDNA ORF Clone, Human, C-Myc tag HG15437-CM
THEM2 cDNA ORF Clone, Human, N-Myc tag HG15437-NM
THEM2 qPCR Primer Pairs, Human HP104061
info info
添加购物车成功! 添加购物车失败!