ACADS cDNA ORF Clone, Human, N-HA tag

Cat: HG15322-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACADS Reagents
CRO Services
Product recommended

All ACADS Reagents
ACADS cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Human acyl-CoA dehydrogenase, C-2 to C-3 short chain with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACADS cDNA ORF Clone, Human, N-HA tag Alternative Names
ACAD3 cDNA ORF Clone, Human;SCAD cDNA ORF Clone, Human
ACADS Background Information
Full Name
acyl-CoA dehydrogenase, C-2 to C-3 short chain

ACADS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACADS cDNA ORF Clone in Cloning Vector, Mouse MG51320-U
ACADS cDNA ORF Clone, Mouse, untagged MG51320-UT
ACADS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51320-ACGLN
ACADS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51320-ACG
ACADS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51320-ANG
ACADS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51320-ACR
ACADS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51320-ANR
ACADS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51320-CF
ACADS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51320-NF
ACADS cDNA ORF Clone, Mouse, C-His tag MG51320-CH
ACADS cDNA ORF Clone, Mouse, N-His tag MG51320-NH
ACADS cDNA ORF Clone, Mouse, C-HA tag MG51320-CY
ACADS cDNA ORF Clone, Mouse, N-HA tag MG51320-NY
ACADS cDNA ORF Clone, Mouse, C-Myc tag MG51320-CM
ACADS cDNA ORF Clone, Mouse, N-Myc tag MG51320-NM
ACADS qPCR Primer Pairs, Mouse MP201197

ACADS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACADS cDNA ORF Clone in Cloning Vector, Human HG15322-G
ACADS cDNA ORF Clone, Human, untagged HG15322-UT
ACADS cDNA ORF Clone, Human, C-GFPSpark® tag HG15322-ACG
ACADS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15322-ACGLN
ACADS cDNA ORF Clone, Human, N-GFPSpark® tag HG15322-ANG
ACADS cDNA ORF Clone, Human, C-OFPSpark® tag HG15322-ACR
ACADS cDNA ORF Clone, Human, N-OFPSpark® tag HG15322-ANR
ACADS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15322-CF
ACADS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15322-NF
ACADS cDNA ORF Clone, Human, C-His tag HG15322-CH
ACADS cDNA ORF Clone, Human, N-His tag HG15322-NH
ACADS cDNA ORF Clone, Human, C-HA tag HG15322-CY
ACADS cDNA ORF Clone, Human, C-Myc tag HG15322-CM
ACADS cDNA ORF Clone, Human, N-Myc tag HG15322-NM
ACADS qPCR Primer Pairs, Human HP103947
info info
添加购物车成功! 添加购物车失败!