ACADL cDNA ORF Clone, Human, N-HA tag

Cat: HG14784-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ACADL Reagents
CRO Services
Product recommended

All ACADL Reagents
ACADL cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Human acyl-CoA dehydrogenase, long chain with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACADL cDNA ORF Clone, Human, N-HA tag Alternative Names
ACAD4 cDNA ORF Clone, Human;LCAD cDNA ORF Clone, Human
ACADL Background Information
Full Name
acyl-CoA dehydrogenase, long chain

ACADL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACADL cDNA ORF Clone in Cloning Vector, Rat RG84360-U
ACADL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84360-ACGLN

ACADL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACADL cDNA ORF Clone in Cloning Vector, Mouse MG52395-G
ACADL cDNA ORF Clone, Mouse, untagged MG52395-UT
ACADL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52395-ACG
ACADL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52395-ACGLN
ACADL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52395-ANG
ACADL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52395-ACR
ACADL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52395-ANR
ACADL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52395-CF
ACADL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52395-NF
ACADL cDNA ORF Clone, Mouse, C-His tag MG52395-CH
ACADL cDNA ORF Clone, Mouse, N-His tag MG52395-NH
ACADL cDNA ORF Clone, Mouse, C-HA tag MG52395-CY
ACADL cDNA ORF Clone, Mouse, N-HA tag MG52395-NY
ACADL cDNA ORF Clone, Mouse, C-Myc tag MG52395-CM
ACADL cDNA ORF Clone, Mouse, N-Myc tag MG52395-NM
ACADL qPCR Primer Pairs, Mouse MP202268

ACADL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACADL cDNA ORF Clone in Cloning Vector, Human HG14784-G
ACADL cDNA ORF Clone, Human, untagged HG14784-UT
ACADL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14784-ACGLN
ACADL cDNA ORF Clone, Human, C-GFPSpark® tag HG14784-ACG
ACADL cDNA ORF Clone, Human, N-GFPSpark® tag HG14784-ANG
ACADL cDNA ORF Clone, Human, C-OFPSpark® tag HG14784-ACR
ACADL cDNA ORF Clone, Human, N-OFPSpark® tag HG14784-ANR
ACADL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14784-CF
ACADL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14784-NF
ACADL cDNA ORF Clone, Human, C-His tag HG14784-CH
ACADL cDNA ORF Clone, Human, N-His tag HG14784-NH
ACADL cDNA ORF Clone, Human, C-HA tag HG14784-CY
ACADL cDNA ORF Clone, Human, C-Myc tag HG14784-CM
ACADL cDNA ORF Clone, Human, N-Myc tag HG14784-NM
ACADL qPCR Primer Pairs, Human HP103417
info info
添加购物车成功! 添加购物车失败!