ACAD8 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14199-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACAD8 Reagents
CRO Services
Product recommended

All ACAD8 Reagents
ACAD8 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Human acyl-CoA dehydrogenase family, member 8 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACAD8 cDNA ORF Clone, Human, C-Myc tag Alternative Names
ACAD-8 cDNA ORF Clone, Human;ARC42 cDNA ORF Clone, Human
ACAD8 Background Information
Full Name
acyl-CoA dehydrogenase family, member 8

ACAD8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACAD8 cDNA ORF Clone in Cloning Vector, Rat RG8A4939-U
ACAD8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4939-ACGLN

ACAD8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACAD8 cDNA ORF Clone in Cloning Vector, Mouse MG51703-G
ACAD8 cDNA ORF Clone, Mouse, untagged MG51703-UT
ACAD8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51703-ACGLN
ACAD8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51703-ACG
ACAD8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51703-ANG
ACAD8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51703-ACR
ACAD8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51703-ANR
ACAD8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51703-CF
ACAD8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51703-NF
ACAD8 cDNA ORF Clone, Mouse, C-His tag MG51703-CH
ACAD8 cDNA ORF Clone, Mouse, N-His tag MG51703-NH
ACAD8 cDNA ORF Clone, Mouse, C-HA tag MG51703-CY
ACAD8 cDNA ORF Clone, Mouse, N-HA tag MG51703-NY
ACAD8 cDNA ORF Clone, Mouse, C-Myc tag MG51703-CM
ACAD8 cDNA ORF Clone, Mouse, N-Myc tag MG51703-NM
ACAD8 qPCR Primer Pairs, Mouse MP201576

ACAD8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACAD8 cDNA ORF Clone in Cloning Vector, Human HG14199-G
ACAD8 cDNA ORF Clone, Human, untagged HG14199-UT
ACAD8 cDNA ORF Clone, Human, C-GFPSpark® tag HG14199-ACG
ACAD8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14199-ACGLN
ACAD8 cDNA ORF Clone, Human, N-GFPSpark® tag HG14199-ANG
ACAD8 cDNA ORF Clone, Human, C-OFPSpark® tag HG14199-ACR
ACAD8 cDNA ORF Clone, Human, N-OFPSpark® tag HG14199-ANR
ACAD8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14199-CF
ACAD8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14199-NF
ACAD8 cDNA ORF Clone, Human, C-His tag HG14199-CH
ACAD8 cDNA ORF Clone, Human, N-His tag HG14199-NH
ACAD8 cDNA ORF Clone, Human, C-HA tag HG14199-CY
ACAD8 cDNA ORF Clone, Human, N-HA tag HG14199-NY
ACAD8 cDNA ORF Clone, Human, N-Myc tag HG14199-NM
ACAD8 qPCR Primer Pairs, Human HP102849
info info
添加购物车成功! 添加购物车失败!