ACAD11 cDNA ORF Clone, Human, N-HA tag

Cat: HG15925-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACAD11 Reagents
CRO Services
Product recommended

All ACAD11 Reagents
ACAD11 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2343 bp
Description
Full length Clone DNA of Human acyl-CoA dehydrogenase family, member 11 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACAD11 cDNA ORF Clone, Human, N-HA tag Alternative Names
ACAD-11 cDNA ORF Clone, Human
ACAD11 Background Information
Full Name
acyl-CoA dehydrogenase family, member 11

ACAD11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACAD11 cDNA ORF Clone in Cloning Vector, Mouse MG5A4011-U
ACAD11 cDNA ORF Clone, Mouse, untagged MG5A4011-UT
ACAD11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4011-ACG
ACAD11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4011-ACGLN
ACAD11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4011-ANG
ACAD11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4011-ACR
ACAD11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4011-ANR
ACAD11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4011-CF
ACAD11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4011-NF
ACAD11 cDNA ORF Clone, Mouse, C-His tag MG5A4011-CH
ACAD11 cDNA ORF Clone, Mouse, N-His tag MG5A4011-NH
ACAD11 cDNA ORF Clone, Mouse, C-HA tag MG5A4011-CY
ACAD11 cDNA ORF Clone, Mouse, N-HA tag MG5A4011-NY
ACAD11 cDNA ORF Clone, Mouse, C-Myc tag MG5A4011-CM
ACAD11 cDNA ORF Clone, Mouse, N-Myc tag MG5A4011-NM

ACAD11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACAD11 cDNA ORF Clone in Cloning Vector, Human HG15925-G
ACAD11 cDNA ORF Clone, Human, untagged HG15925-UT
ACAD11 cDNA ORF Clone, Human, C-GFPSpark® tag HG15925-ACG
ACAD11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15925-ACGLN
ACAD11 cDNA ORF Clone, Human, N-GFPSpark® tag HG15925-ANG
ACAD11 cDNA ORF Clone, Human, C-OFPSpark® tag HG15925-ACR
ACAD11 cDNA ORF Clone, Human, N-OFPSpark® tag HG15925-ANR
ACAD11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15925-CF
ACAD11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15925-NF
ACAD11 cDNA ORF Clone, Human, C-His tag HG15925-CH
ACAD11 cDNA ORF Clone, Human, N-His tag HG15925-NH
ACAD11 cDNA ORF Clone, Human, C-HA tag HG15925-CY
ACAD11 cDNA ORF Clone, Human, C-Myc tag HG15925-CM
ACAD11 cDNA ORF Clone, Human, N-Myc tag HG15925-NM
ACAD11 qPCR Primer Pairs, Human HP104514
info info
添加购物车成功! 添加购物车失败!