Quick Order

Text Size:AAA

Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human ACAA1 cDNA Clone Product Information
NCBI RefSeq:BC000635
RefSeq ORF Size:1275bp
cDNA Description:Full length Clone DNA of Homo sapiens acetyl-CoA acyltransferase 1 with N terminal HA tag.
Gene Synonym:ACAA, THIO, PTHIO
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14781-ACG$225
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14781-ACR$225
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14781-ANG$225
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14781-ANR$225
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, C-Flag tagHG14781-CF$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, C-His tagHG14781-CH$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, C-Myc tagHG14781-CM$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, C-HA tagHG14781-CY$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone in cloning vectorHG14781-G$75
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-Flag tagHG14781-NF$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-His tagHG14781-NH$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-Myc tagHG14781-NM$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmid, N-HA tagHG14781-NY$195
Human ACAA1/Peroxisomal 3-oxoacyl-CoA thiolase Gene ORF cDNA clone expression plasmidHG14781-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG14781-NY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"