bpoz/ABTB1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14834-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All bpoz/ABTB1 Reagents
CRO Services
Product recommended

All bpoz/ABTB1 Reagents
bpoz/ABTB1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Description
Full length Clone DNA of Human ankyrin repeat and BTB (POZ) domain containing 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

bpoz/ABTB1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
BPOZ cDNA ORF Clone, Human;BTB3 cDNA ORF Clone, Human;BTBD21 cDNA ORF Clone, Human;EF1ABP cDNA ORF Clone, Human;PP2259 cDNA ORF Clone, Human
bpoz/ABTB1 Background Information
Full Name
ankyrin repeat and BTB (POZ) domain containing 1

bpoz/ABTB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
bpoz/ABTB1 cDNA ORF Clone in Cloning Vector, Mouse MG51517-G
bpoz/ABTB1 cDNA ORF Clone, Mouse, untagged MG51517-UT
bpoz/ABTB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51517-ACGLN
bpoz/ABTB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51517-ACG
bpoz/ABTB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51517-ANG
bpoz/ABTB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51517-ACR
bpoz/ABTB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51517-ANR
bpoz/ABTB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51517-CF
bpoz/ABTB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51517-NF
bpoz/ABTB1 cDNA ORF Clone, Mouse, C-His tag MG51517-CH
bpoz/ABTB1 cDNA ORF Clone, Mouse, N-His tag MG51517-NH
bpoz/ABTB1 cDNA ORF Clone, Mouse, C-HA tag MG51517-CY
bpoz/ABTB1 cDNA ORF Clone, Mouse, N-HA tag MG51517-NY
bpoz/ABTB1 cDNA ORF Clone, Mouse, C-Myc tag MG51517-CM
bpoz/ABTB1 cDNA ORF Clone, Mouse, N-Myc tag MG51517-NM
bpoz/ABTB1 qPCR Primer Pairs, Mouse MP201401

bpoz/ABTB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
bpoz/ABTB1 cDNA ORF Clone in Cloning Vector, Human HG14834-G
bpoz/ABTB1 cDNA ORF Clone, Human, untagged HG14834-UT
bpoz/ABTB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14834-ACGLN
bpoz/ABTB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14834-ACG
bpoz/ABTB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14834-ANG
bpoz/ABTB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14834-ACR
bpoz/ABTB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14834-ANR
bpoz/ABTB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14834-CF
bpoz/ABTB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14834-NF
bpoz/ABTB1 cDNA ORF Clone, Human, C-His tag HG14834-CH
bpoz/ABTB1 cDNA ORF Clone, Human, N-His tag HG14834-NH
bpoz/ABTB1 cDNA ORF Clone, Human, C-HA tag HG14834-CY
bpoz/ABTB1 cDNA ORF Clone, Human, N-HA tag HG14834-NY
bpoz/ABTB1 cDNA ORF Clone, Human, N-Myc tag HG14834-NM
bpoz/ABTB1 qPCR Primer Pairs, Human HP103465
info info
添加购物车成功! 添加购物车失败!