c-Abl cDNA ORF Clone, Human, C-His tag

Cat: HG11199-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All c-Abl Reagents
CRO Services
Product recommended

All c-Abl Reagents
c-Abl cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3450 bp
Description
Full length Clone DNA of Human c-abl oncogene 1, receptor tyrosine kinase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

c-Abl cDNA ORF Clone, Human, C-His tag Alternative Names
ABL cDNA ORF Clone, Human;bcr/abl cDNA ORF Clone, Human;c-ABL cDNA ORF Clone, Human;c-ABL1 cDNA ORF Clone, Human;JTK7 cDNA ORF Clone, Human;p150 cDNA ORF Clone, Human;v-abl cDNA ORF Clone, Human
c-Abl Background Information

c-Abl belongs to the class of tyrosine kinases and is the prototype of a subfamily which includes two members, c-Abl and Arg (Abl-related gene). Both proteins are localized at the cell membrane, actin cytoskeleton and cytosol, and c-Abl is present in the nucleus as well. c-Abl is a non-receptor tyrosine kinase that participates in multiple signaling pathways linking the cell surface, cytoskeleton, and the nucleus. Recent in vitro studies have also linked c-Abl to amyloid-beta-induced toxicity and tau phosphorylation. c-Abl has been implicated in many cellular processes including differentiation, division, adhesion, death, and stress response. c-Abl is a latent tyrosine kinase that becomes activated in response to numerous extra- and intra-cellular stimuli. The c-Abl protein is a ubiquitously expressed nonreceptor tyrosine kinase involved in the development and function of many mammalian organ systems, including the immune system and bone. It regulates the cellular response to TAM through functional interaction with the estrogen receptor, which suggests c-Abl as a therapeutic target and a prognostic tumor marker for breast cancer. c-Abl also plays a key role in signaling chemokine-induced T-cell migration. In addition, c-Abl contains NLSs (nuclear localization signals) and DNA-binding sequences important for nuclear functions. c-Abl has become an important therapeutic target in human chronic myeloid leukaemia.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
ABL proto-oncogene 1, non-receptor tyrosine kinase
References
  • Qiu Z, et al. (2010) c-Abl tyrosine kinase regulates cardiac growth and development. Proc Natl Acad Sci U S A. 107(3): 1136-41.
  • Huang Y, et al. (2008) The c-Abl tyrosine kinase regulates actin remodeling at the immune synapse. Blood. 112(1): 111-9.
  • Sirvent A, et al. (2008) Cytoplasmic signalling by the c-Abl tyrosine kinase in normal and cancer cells. Biol Cell. 100(11): 617-31.
  • Shaul Y, et al. (2005) Role of c-Abl in the DNA damage stress response. Cell Res. 15(1): 33-5.
  • info info
    添加购物车成功! 添加购物车失败!