ABHD3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14194-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ABHD3 Reagents
CRO Services
Product recommended

All ABHD3 Reagents
ABHD3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1230 bp
Description
Full length Clone DNA of Human abhydrolase domain containing 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ABHD3 cDNA ORF Clone, Human, C-Myc tag Alternative Names
LABH3 cDNA ORF Clone, Human
ABHD3 Background Information
Full Name
abhydrolase domain containing 3

ABHD3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ABHD3 cDNA ORF Clone in Cloning Vector, Mouse MG52250-U
ABHD3 cDNA ORF Clone, Mouse, untagged MG52250-UT
ABHD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52250-ACGLN
ABHD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52250-ACG
ABHD3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52250-ANG
ABHD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52250-ACR
ABHD3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52250-ANR
ABHD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52250-CF
ABHD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52250-NF
ABHD3 cDNA ORF Clone, Mouse, C-His tag MG52250-CH
ABHD3 cDNA ORF Clone, Mouse, N-His tag MG52250-NH
ABHD3 cDNA ORF Clone, Mouse, C-HA tag MG52250-CY
ABHD3 cDNA ORF Clone, Mouse, N-HA tag MG52250-NY
ABHD3 cDNA ORF Clone, Mouse, C-Myc tag MG52250-CM
ABHD3 cDNA ORF Clone, Mouse, N-Myc tag MG52250-NM
ABHD3 qPCR Primer Pairs, Mouse MP202123

ABHD3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ABHD3 cDNA ORF Clone in Cloning Vector, Human HG14194-G
ABHD3 cDNA ORF Clone, Human, untagged HG14194-UT
ABHD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14194-ACGLN
ABHD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14194-ACG
ABHD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14194-ACR
ABHD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14194-CF
ABHD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14194-NF
ABHD3 cDNA ORF Clone, Human, C-His tag HG14194-CH
ABHD3 cDNA ORF Clone, Human, N-His tag HG14194-NH
ABHD3 cDNA ORF Clone, Human, C-HA tag HG14194-CY
ABHD3 cDNA ORF Clone, Human, N-HA tag HG14194-NY
ABHD3 cDNA ORF Clone, Human, N-Myc tag HG14194-NM
ABHD3 qPCR Primer Pairs, Human HP102845
info info
添加购物车成功! 添加购物车失败!