ABHD14A cDNA ORF Clone, Human, untagged

Cat: HG13326-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ABHD14A Reagents
CRO Services
Product recommended

All ABHD14A Reagents
ABHD14A cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Human abhydrolase domain containing 14A.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ABHD14A cDNA ORF Clone, Human, untagged Alternative Names
DORZ1 cDNA ORF Clone, Human
ABHD14A Background Information
Full Name
abhydrolase domain containing 14A

ABHD14A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ABHD14A cDNA ORF Clone in Cloning Vector, Mouse MG53897-U
ABHD14A cDNA ORF Clone, Mouse, untagged MG53897-UT
ABHD14A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53897-ACGLN
ABHD14A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53897-ACG
ABHD14A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53897-ANG
ABHD14A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53897-ACR
ABHD14A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53897-ANR
ABHD14A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53897-CF
ABHD14A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53897-NF
ABHD14A cDNA ORF Clone, Mouse, C-His tag MG53897-CH
ABHD14A cDNA ORF Clone, Mouse, N-His tag MG53897-NH
ABHD14A cDNA ORF Clone, Mouse, C-HA tag MG53897-CY
ABHD14A cDNA ORF Clone, Mouse, N-HA tag MG53897-NY
ABHD14A cDNA ORF Clone, Mouse, C-Myc tag MG53897-CM
ABHD14A cDNA ORF Clone, Mouse, N-Myc tag MG53897-NM

ABHD14A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ABHD14A cDNA ORF Clone in Cloning Vector, Human HG13326-G
ABHD14A cDNA ORF Clone, Human, C-GFPSpark® tag HG13326-ACG
ABHD14A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13326-ACGLN
ABHD14A cDNA ORF Clone, Human, N-GFPSpark® tag HG13326-ANG
ABHD14A cDNA ORF Clone, Human, C-OFPSpark® tag HG13326-ACR
ABHD14A cDNA ORF Clone, Human, N-OFPSpark® tag HG13326-ANR
ABHD14A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13326-CF
ABHD14A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13326-NF
ABHD14A cDNA ORF Clone, Human, C-His tag HG13326-CH
ABHD14A cDNA ORF Clone, Human, N-His tag HG13326-NH
ABHD14A cDNA ORF Clone, Human, C-HA tag HG13326-CY
ABHD14A cDNA ORF Clone, Human, N-HA tag HG13326-NY
ABHD14A cDNA ORF Clone, Human, C-Myc tag HG13326-CM
ABHD14A cDNA ORF Clone, Human, N-Myc tag HG13326-NM
ABHD14A qPCR Primer Pairs, Human HP102031
info info
添加购物车成功! 添加购物车失败!